View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3974_low_16 (Length: 241)

Name: NF3974_low_16
Description: NF3974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3974_low_16
NF3974_low_16
[»] chr3 (3 HSPs)
chr3 (1-224)||(53376232-53376456)
chr3 (1-152)||(53403309-53403460)
chr3 (180-224)||(53403266-53403310)


Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 53376232 - 53376456
Alignment:
1 aaaatatgaaggaagatggaaagaatgggagaacctctgttttaggagtgaagaatgaagatggaaacggaggatgattctttgtcagaggttcaaaccg 100  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
53376232 aaaatatgaaggaagatggaaagaaggggagaacctctgttttaggagtgaagaatgaagatggaaacggaggatgattcttcgtcagaggttcaaaccg 53376331  T
101 gaacttgaaggagagaggaatgctctgttttctgtttttccttcttcagcggagcgtta-tgcagccgcacgaatcaagaggtaaccctaaacagagatt 199  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||    
53376332 gaacttgaaggagagaggaatgctctgttttctgtttttccctcttcagcggagcgttattgcagccgcacgaatcaagaggtaaccctaaacggagatt 53376431  T
200 gatatggtcggaatgcgagggagat 224  Q
    |||||||||||||||||| ||||||    
53376432 gatatggtcggaatgcgatggagat 53376456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 1 - 152
Target Start/End: Complemental strand, 53403460 - 53403309
Alignment:
1 aaaatatgaaggaagatggaaagaatgggagaacctctgttttaggagtgaagaatgaagatggaaacggaggatgattctttgtcagaggttcaaaccg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
53403460 aaaatatgaaggaagatggaaagaatgggagaacctctgttttaggagtgaagaatgaagatggaaacggaggatgattcttcgtcagaggttcaaaccg 53403361  T
101 gaacttgaaggagagaggaatgctctgttttctgtttttccttcttcagcgg 152  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||    
53403360 gaacttgaaggagagaggaatgctctgttttctgtttttccctcttcagcgg 53403309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 180 - 224
Target Start/End: Complemental strand, 53403310 - 53403266
Alignment:
180 ggtaaccctaaacagagattgatatggtcggaatgcgagggagat 224  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
53403310 ggtaaccctaaacagagattgatatggtcggaatgcgagggagat 53403266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University