View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3975_high_9 (Length: 219)
Name: NF3975_high_9
Description: NF3975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3975_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 16 - 203
Target Start/End: Complemental strand, 12021621 - 12021434
Alignment:
| Q |
16 |
atactattagttgtttatattcgaaaatttagcggagattcctaatctagcacctacctgatatcttccataaaaagttgtttgggattttctatcaatc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12021621 |
atactattagttgtttatattcgaaaatttagctgagattcctaatccagcacctacctgatatcttccataaaaagttgtttgggattttctatcaatc |
12021522 |
T |
|
| Q |
116 |
cagatattgacacactgtatctgctctgccaatcatgtcataagaaaagaagttaaaattcgtcgacagtgaacaccagtgaccaaag |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12021521 |
cagatattgacacactgtatctgctctgccaaacatgtcataagaaaagaagttaaaattcgtcgacagtgaacaccagtgaccaaag |
12021434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University