View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3975_low_6 (Length: 276)
Name: NF3975_low_6
Description: NF3975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3975_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 272
Target Start/End: Original strand, 46445220 - 46445495
Alignment:
| Q |
1 |
ctctactttttagttttgtgcatcactgtttcatcaccattgagaatgattt--gtgttaagagataggtgaccatcaccccggtaatctgtataaacct |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46445220 |
ctctactttttagttttgtgcatcactgtttcatcaccattgagaatgattttagtgttaagagataggtgaccatcaccccggtaatctgtataaacct |
46445319 |
T |
 |
| Q |
99 |
gcttgtctgcttcgaagttttttgttgagtgacttattagctatgtagcaaatgacacttcaaattaaa--tgtgttggaggatccaacatgtgtcggtg |
196 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
46445320 |
gcttgtctgctttgaagttttttgttgagtgacttattagctatgtagcaaatgacacttcaaattaaatgtgtgttggaggatccaacatgtgtcggtg |
46445419 |
T |
 |
| Q |
197 |
tccgacactaacatgtgtagtacattcgaacactttcatttatcaaattttaccagtatatgtcagggtgatatcc |
272 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46445420 |
tccgacactaataggtgtagtacattcgaacactttcatttatcaaattttaccagtatatgtcagggtgatatcc |
46445495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University