View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3975_low_8 (Length: 220)
Name: NF3975_low_8
Description: NF3975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3975_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 2 - 204
Target Start/End: Complemental strand, 16422898 - 16422698
Alignment:
| Q |
2 |
gaggagccactgatatgcgtcacaatgtcccggttctgtatatgtatttaaataaatactatcaata-tgtatactaatattgcttctagaaaaatgtat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
16422898 |
gaggagccactgatatgcgtcacaatgtcccggttccgtatatgtatttaaataaata---tcaataatgtatactaatattgcttctaaaaaaatgtat |
16422802 |
T |
|
| Q |
101 |
attttttatatgagaggtgctacggatgacattatcacgaaatttcacgaattgcaaattattattttctcttgtgcagcttttgctagttttcgatata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
16422801 |
attttttatatgagaggtgctacggatgacattatcacgaaatttcacgaattgcaaattattatcttctcttgtgcagcttttgctagttttctatata |
16422702 |
T |
|
| Q |
201 |
aaac |
204 |
Q |
| |
|
|||| |
|
|
| T |
16422701 |
aaac |
16422698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University