View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3976_low_1 (Length: 361)
Name: NF3976_low_1
Description: NF3976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3976_low_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 6e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 11 - 144
Target Start/End: Complemental strand, 43343929 - 43343796
Alignment:
| Q |
11 |
cacagataccaacactaatcgaacggcaagatgagcagcaggatgttgttagtcacacgagacaatgtgctacagcagattcctttctcgattgtgatat |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43343929 |
cacaaataccaacactaatcgaacggcaagatgagcagcaggatgttgttagtcacacgatacaatgtgctacagcagattcctttctcgattgtgatat |
43343830 |
T |
|
| Q |
111 |
catcattatattgggatatgtgggaagaaaaaaa |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
43343829 |
catcattatattgggatatgtgggaagaaaaaaa |
43343796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 220 - 287
Target Start/End: Complemental strand, 43343697 - 43343630
Alignment:
| Q |
220 |
tcatgggatctgcatgtttttattgcacaagacctgcaactatggatcatgcaaatcctctccctttt |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43343697 |
tcatgggatctgcatgtttttattgcacaagacctgcaactatggatcatgcaaatcctctccctttt |
43343630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University