View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3977_high_2 (Length: 234)
Name: NF3977_high_2
Description: NF3977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3977_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 56469220 - 56469437
Alignment:
| Q |
1 |
ctcaaaaccaacccacataactctggtgcttctaagaatggaggctcatcaatcacaggaaacccattatgtcgcgtcacctttaaagtgtgcacaatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56469220 |
ctcaaaaccaacccacataactctggagcttctaagaatggaggctcatcaatcacaggaaacccattatgtcgcgtcacctttaaagtgtgcacaatat |
56469319 |
T |
 |
| Q |
101 |
tccccactttttcaataccagagaatgtaaacagtggaccagaaacaacatcaccggcaactaaatgcctcatgtacggttctgcatgcacttccaaata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56469320 |
tccccactttttcaataccagagaatgtaaacagtggaccagaaacaacatcaccggcaactaaatgcctcatgtacggttctgcatgcacttccaaata |
56469419 |
T |
 |
| Q |
201 |
aggcaaccccttcatttc |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
56469420 |
aggcaaccccttcatttc |
56469437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 76 - 203
Target Start/End: Complemental strand, 155259 - 155132
Alignment:
| Q |
76 |
gtcacctttaaagtgtgcacaatattccccactttttcaataccagagaatgtaaacagtggaccagaaacaacatcaccggcaactaaatgcctcatgt |
175 |
Q |
| |
|
||||| || |||| ||||| ||||||||||||||||| || ||| | || | |||||||||||||||||||||||| || |||||||||| |||||||| |
|
|
| T |
155259 |
gtcactttcaaagcgtgcaatatattccccactttttcgatcccacaaaaagaaaacagtggaccagaaacaacatcccctgcaactaaattcctcatgt |
155160 |
T |
 |
| Q |
176 |
acggttctgcatgcacttccaaataagg |
203 |
Q |
| |
|
| || |||||||| |||||| |||||| |
|
|
| T |
155159 |
atggctctgcatgtgcttccatataagg |
155132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University