View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3978_low_2 (Length: 550)
Name: NF3978_low_2
Description: NF3978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3978_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 1e-48; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 404 - 536
Target Start/End: Complemental strand, 16779719 - 16779590
Alignment:
| Q |
404 |
caatagtcattgaaaactttcacataaatgaagtagtcatcaaagttaaaaccccaaccacggcatcccccaacattttttgcaagttgagttattgaac |
503 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
16779719 |
caatagtcattagaaactttcacataaatgaagtagtca---aagttaaaaccccaaccacggcatccgctaacattttttgcaagttgagttattgaac |
16779623 |
T |
|
| Q |
504 |
acattggtaatacgtaattttatgtgttcaaat |
536 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
16779622 |
acattggtaatgcgtaattttatgtgttcaaat |
16779590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 20 - 113
Target Start/End: Complemental strand, 16780146 - 16780052
Alignment:
| Q |
20 |
taggggtgctgaaagagagacagatatatgagagagacagggtgtggatgaa-ttggtggggatgttgctttatggggtacacatgggatgaagg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16780146 |
taggggtgctgaaagagagacagatatatgagagagacagggtgtggaggaatttggtggggatgttgctttatggggtacacatgggatgaagg |
16780052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 229 - 303
Target Start/End: Complemental strand, 16779936 - 16779861
Alignment:
| Q |
229 |
tttgtactcattgtagtaa-gcatcaacaaaaaattcagcaaaaaagtgttttactataataagtggtatttaact |
303 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16779936 |
tttgtactcattgtagtaaagcatcaacaaaaaattcagcaaaaaagtgttttactataataagtggtatttaact |
16779861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University