View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3978_low_6 (Length: 312)
Name: NF3978_low_6
Description: NF3978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3978_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 68 - 297
Target Start/End: Complemental strand, 530335 - 530106
Alignment:
| Q |
68 |
ccttagtataatcgaagagaatagatttattgttggccatgatgaagaggttaccatcgacattgagaaaaacaaaaggatacaagttattttcttgctt |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
530335 |
ccttagtataatcgaagagaatagatttattgttggccatgataaagaggttaccatcgacattgagaaaaacaaaaggatacaagttattttcttgctc |
530236 |
T |
 |
| Q |
168 |
aggatcattggtctcagccaaaaatggtaaactataatttgcattgatatcattgcttttgggataaaactcatagttgaattgccccctaccaccaaca |
267 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
530235 |
aggatcattggtctcagccaaaaatgataaactataatttgcattgatatcattgcttttgggataaaactcatagttgaattgccccctaccaccaaca |
530136 |
T |
 |
| Q |
268 |
acaatctgactaccattagggaggatatgg |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
530135 |
acaatctgactaccattagggaggatatgg |
530106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 68 - 158
Target Start/End: Complemental strand, 7570269 - 7570179
Alignment:
| Q |
68 |
ccttagtataatcgaagagaatagatttattgttggccatgatgaagaggttaccatcgacattgagaaaaacaaaaggatacaagttatt |
158 |
Q |
| |
|
||||||||||||| ||||| |||| | | ||||| || | |||||||||||| ||||| |||||||||| |||||| |||||||| ||||| |
|
|
| T |
7570269 |
ccttagtataatcaaagaggatagctctgttgttagcaaagatgaagaggttgccatccacattgagaataacaaatggatacaaattatt |
7570179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University