View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3978_low_6 (Length: 312)

Name: NF3978_low_6
Description: NF3978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3978_low_6
NF3978_low_6
[»] chr6 (1 HSPs)
chr6 (68-297)||(530106-530335)
[»] chr1 (1 HSPs)
chr1 (68-158)||(7570179-7570269)


Alignment Details
Target: chr6 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 68 - 297
Target Start/End: Complemental strand, 530335 - 530106
Alignment:
68 ccttagtataatcgaagagaatagatttattgttggccatgatgaagaggttaccatcgacattgagaaaaacaaaaggatacaagttattttcttgctt 167  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||     
530335 ccttagtataatcgaagagaatagatttattgttggccatgataaagaggttaccatcgacattgagaaaaacaaaaggatacaagttattttcttgctc 530236  T
168 aggatcattggtctcagccaaaaatggtaaactataatttgcattgatatcattgcttttgggataaaactcatagttgaattgccccctaccaccaaca 267  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
530235 aggatcattggtctcagccaaaaatgataaactataatttgcattgatatcattgcttttgggataaaactcatagttgaattgccccctaccaccaaca 530136  T
268 acaatctgactaccattagggaggatatgg 297  Q
    ||||||||||||||||||||||||||||||    
530135 acaatctgactaccattagggaggatatgg 530106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 68 - 158
Target Start/End: Complemental strand, 7570269 - 7570179
Alignment:
68 ccttagtataatcgaagagaatagatttattgttggccatgatgaagaggttaccatcgacattgagaaaaacaaaaggatacaagttatt 158  Q
    ||||||||||||| ||||| |||| | | ||||| || | |||||||||||| ||||| |||||||||| |||||| |||||||| |||||    
7570269 ccttagtataatcaaagaggatagctctgttgttagcaaagatgaagaggttgccatccacattgagaataacaaatggatacaaattatt 7570179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University