View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3979_high_12 (Length: 236)
Name: NF3979_high_12
Description: NF3979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3979_high_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 42022959 - 42023179
Alignment:
| Q |
1 |
ttagaatatcatctctttcatttataaacaacccaaaagttgtccataacaatctgaaccccatctcatagaagtaaaaatatggataacaaccggtccc |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42022959 |
ttagaatatcatctctttcatttatgaacaacccaaaagttgtccataacaatctgaaccccatctcatagaagtaaaaatatggataacaaccggtccc |
42023058 |
T |
|
| Q |
101 |
ttaacaatagggatgtagagaacattaatagttgataattgaccaactgacagacaatgagccatctcaaaagtttatttttgccctcaattagcatgct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42023059 |
ttaacaatagggatgtagagaacattaatagttgataattggctaactgacagacaatgagccatctcaaaagtttatttttgccctcaattagcatgct |
42023158 |
T |
|
| Q |
201 |
tccttgataattgggttgtgg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
42023159 |
tccttgataattgggttgtgg |
42023179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 45134663 - 45134621
Alignment:
| Q |
1 |
ttagaatatcatctctttcatttataaacaacccaaaagttgt |
43 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
45134663 |
ttagaatattatctctctcatttataaacaacccaaaagttgt |
45134621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 11927132 - 11927182
Alignment:
| Q |
1 |
ttagaatatcatctctttcatttataaacaacccaaaagttgtccataaca |
51 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||| ||| ||| ||||||||| |
|
|
| T |
11927132 |
ttagaatattatctctttcatttatgaacaaccaaaaggttttccataaca |
11927182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 12 - 52
Target Start/End: Original strand, 36866303 - 36866343
Alignment:
| Q |
12 |
tctctttcatttataaacaacccaaaagttgtccataacaa |
52 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||| |||||||| |
|
|
| T |
36866303 |
tctctttcatttatgaacaaccaaaaagttgttcataacaa |
36866343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University