View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3980_low_3 (Length: 252)
Name: NF3980_low_3
Description: NF3980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3980_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 84 - 229
Target Start/End: Complemental strand, 56311894 - 56311749
Alignment:
| Q |
84 |
tactactgtaactgtagctgtagctcctttgttaatattatcgttagaagttccatcttcgtgactcaagctcatgctgctcatgttaggtgatgatgtt |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56311894 |
tactactgtaactgtagctgtagctcctttgttaatattatcgttagaagttccatcttcgtgactcaagctcatgctgctcatgttaggtgatgatgtt |
56311795 |
T |
 |
| Q |
184 |
gctgctgctattgccatccactctctctaactaactaacaacaaca |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56311794 |
gctgctgctattgccatccactctctctaactaactaacaacaaca |
56311749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 56311983 - 56311922
Alignment:
| Q |
1 |
tctacaagttcttcttcagttggatggaaacgaaaccctggcataaccacgtcatgctcgtg |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56311983 |
tctacaagttcttcttcagttggatggaaacgaaaccctggcataaccacgtcatgctcgtg |
56311922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 41
Target Start/End: Complemental strand, 8449761 - 8449724
Alignment:
| Q |
4 |
acaagttcttcttcagttggatggaaacgaaaccctgg |
41 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
8449761 |
acaagttcttcatcagttgggtggaaacgaaaccctgg |
8449724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University