View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3980_low_4 (Length: 249)
Name: NF3980_low_4
Description: NF3980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3980_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 19 - 242
Target Start/End: Complemental strand, 10760935 - 10760712
Alignment:
| Q |
19 |
aggccttgctatggagggaaatattttcttgccttcaacttgaatagagactttaacataagcttgactttgggattggacttgtgttaaaatgctgata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
10760935 |
aggccttgctatggagggaaatattttcttgccttcaacttgaatagagactttaacataagcttggctttgggattggacttgtgttaatatgctgata |
10760836 |
T |
|
| Q |
119 |
ggtgttttgcatcttataatctcttgagcaactgatagaacatcagatttaaataagaaattgggcttcgtgaaatcccaaccatatacacattggaatc |
218 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10760835 |
ggtgttttgcatcttattatctcttgagcaactgatagaacatcagatttaaataagaaattcggcttcgtgaaatcccaaccatatacacattggaatc |
10760736 |
T |
|
| Q |
219 |
tagagggttcacctaatttctctg |
242 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
10760735 |
tagagggttcacctaatttctctg |
10760712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University