View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3981_low_10 (Length: 223)
Name: NF3981_low_10
Description: NF3981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3981_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 210
Target Start/End: Original strand, 1252182 - 1252373
Alignment:
| Q |
18 |
tatgtcaactgtatgggcaaccatacttactcccatttatttcttgctcaatttgtgcagagttcaaagatcaaaagagatcagggattcgtactcttta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1252182 |
tatgtcaactgtatgggcaaccatacttactcccatttatttcttgctcaatttgggcagagttcaaagatcaaaagagatcagtgattcgtactcttta |
1252281 |
T |
 |
| Q |
118 |
tcattccttggtttgtcgcactttgtgttaagaagtcatcaataatagagcatgcggtgtggctttttatgtgatgggatcgtttccctatgc |
210 |
Q |
| |
|
||||||| || ||||| |||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1252282 |
tcattccatgttttgttgcac-ttgtgttcagaagtcatcaataatagagcatgcggtgtggctttttatgtgatgggatggtttccctatgc |
1252373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University