View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3981_low_5 (Length: 325)
Name: NF3981_low_5
Description: NF3981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3981_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 3e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 3 - 154
Target Start/End: Original strand, 42168703 - 42168854
Alignment:
| Q |
3 |
atcaaaggtccttggaatcacatgatgaatatgatagatagttagttccgaggtcataaataatcgttgctccaaacttccctttttccactgcggcact |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42168703 |
atcaaaggtccttggaatcacatgatgaatatgatagatagttagttccgaggtcataaataatcgttgcaccaaacttccctttttccactgcggcact |
42168802 |
T |
|
| Q |
103 |
aagatagacacaaaatatagtagccacgtgtcgcttctttgtttgacaatca |
154 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
42168803 |
aagatagacacaaaatatagcagccacgtgtcgcttctttgtttgataatca |
42168854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 181 - 316
Target Start/End: Original strand, 42168851 - 42168987
Alignment:
| Q |
181 |
atcatcgtttgtttctttgtgt-gttgttgcttcattacactgttgtttcttgctcagtgttcttttcttgttcacacaatgacagacactacagatgat |
279 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42168851 |
atcatcgtttgtttctttgtgttgttgttgcttcattacactgttgtttcttgctcagtgttcttttcttgttcacacaatgacagacactacagatgat |
42168950 |
T |
|
| Q |
280 |
attgctgaagaaatctcgttccagagctttgatgatg |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42168951 |
attgctgaagaaatctcgttccagagctttgatgatg |
42168987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University