View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3981_low_8 (Length: 250)
Name: NF3981_low_8
Description: NF3981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3981_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 130 - 244
Target Start/End: Original strand, 16254937 - 16255051
Alignment:
| Q |
130 |
tcttactaatgacaggaatattgatttgttgggtaatttgttggagaaaatcataggaattcatgtctgacatttgttcttcaattagtatcacatcaaa |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
16254937 |
tcttactaatgacaggaatattgatttgttgggtaatttgttggagaaaatcataggaattcatgtctgaaatttgttcttcaattagtatcacatcaaa |
16255036 |
T |
|
| Q |
230 |
acaaccctttgcttc |
244 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
16255037 |
acaaccctttgcttc |
16255051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 16254807 - 16254872
Alignment:
| Q |
1 |
ccccgtttgcaatagccttcatagctgcacttgttgatccatctttacccatcactgcacatgtca |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16254807 |
ccccgtttgcaatagccttcatagctgcacttgttgatccatctttacccatcactgcacatgtca |
16254872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 130 - 228
Target Start/End: Original strand, 38880670 - 38880768
Alignment:
| Q |
130 |
tcttactaatgacaggaatattgatttgttgggtaatttgttggagaaaatcataggaattcatgtctgacatttgttcttcaattagtatcacatcaa |
228 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||| ||| ||| ||||||||| |||| |||||||| |||||| |||||||||||| |||||||| |
|
|
| T |
38880670 |
tcttactgatgacagaaatattgatttgttgggtaacatgtcggacaaaatcatatgaatccatgtctggcatttgagcttcaattagtaccacatcaa |
38880768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University