View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3983_high_14 (Length: 240)
Name: NF3983_high_14
Description: NF3983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3983_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 18 - 110
Target Start/End: Complemental strand, 1158592 - 1158500
Alignment:
| Q |
18 |
actactcaccttgaggctgctgatttcgtcgaatgagcaagcaaaacgaatatgcattaagtgattacttaagaatatgtacatacttatgaa |
110 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1158592 |
actactcaccttaaggctgctgatttcgttgaatgagcaaacaaaatgaatatgcattaagtgattacttaagaatatgtacatacttatgaa |
1158500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 212 - 240
Target Start/End: Complemental strand, 1158417 - 1158389
Alignment:
| Q |
212 |
atttactctctctttaatcttatttttat |
240 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1158417 |
atttactctctctttaatcttatttttat |
1158389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University