View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3983_low_13 (Length: 248)
Name: NF3983_low_13
Description: NF3983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3983_low_13 |
 |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
| [»] scaffold0151 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 70; Significance: 1e-31; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 38 - 107
Target Start/End: Complemental strand, 9071946 - 9071877
Alignment:
| Q |
38 |
cccttttgcaaaacaccaattttgacttggtcaatcatatgtgtcacgccagctgtgtatattttgaatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9071946 |
cccttttgcaaaacaccaattttgacttggtcaatcatatgtgtcacgccagctgtgtatattttgaatt |
9071877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 14 - 97
Target Start/End: Original strand, 2023399 - 2023482
Alignment:
| Q |
14 |
tggcaaaagtaacaccatgtctatcccttttgcaaaacaccaattttgacttggtcaatcatatgtgtcacgccagctgtgtat |
97 |
Q |
| |
|
|||||||||| || |||| |||| |||||||||||||| ||||||| |||||||||| |||||||| || |||| |||||||| |
|
|
| T |
2023399 |
tggcaaaagtgaccccatatctaccccttttgcaaaacgtcaattttaacttggtcaaccatatgtggcatgccacctgtgtat |
2023482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 14 - 97
Target Start/End: Complemental strand, 183178 - 183094
Alignment:
| Q |
14 |
tggcaaaagtaacaccatgtctatccc-ttttgcaaaacaccaattttgacttggtcaatcatatgtgtcacgccagctgtgtat |
97 |
Q |
| |
|
|||||||||| || ||||||||| ||| ||||||||||| ||||||||||| ||||||| |||||| ||||||| |||||||| |
|
|
| T |
183178 |
tggcaaaagtgaccccatgtctacccccttttgcaaaacgtcaattttgactcagtcaatcctatgtggcacgccacctgtgtat |
183094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 14 - 93
Target Start/End: Complemental strand, 16799908 - 16799829
Alignment:
| Q |
14 |
tggcaaaagtaacaccatgtctatcccttttgcaaaacaccaattttgacttggtcaatcatatgtgtcacgccagctgt |
93 |
Q |
| |
|
|||||||||| || ||| ||||| ||||||||||||| ||||||||||| ||||| |||||||| ||||||| |||| |
|
|
| T |
16799908 |
tggcaaaagtgaccccacgtctaccccttttgcaaaaggtcaattttgactcagtcaaccatatgtggcacgccacctgt |
16799829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 38 - 97
Target Start/End: Original strand, 38107220 - 38107279
Alignment:
| Q |
38 |
cccttttgcaaaacaccaattttgacttggtcaatcatatgtgtcacgccagctgtgtat |
97 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||| |||||||| || |||| |||||||| |
|
|
| T |
38107220 |
cccttttgcaaaacgtcaattttgactcggtcaaccatatgtggcatgccacctgtgtat |
38107279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 67; Significance: 7e-30; HSPs: 7)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 29 - 107
Target Start/End: Complemental strand, 45519465 - 45519387
Alignment:
| Q |
29 |
catgtctatcccttttgcaaaacaccaattttgacttggtcaatcatatgtgtcacgccagctgtgtatattttgaatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
45519465 |
catgtctatcccttttgcaaaacaccaattttaacttggtcaatcatatatgtcacgccagctgtgtacattttgaatt |
45519387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 38 - 88
Target Start/End: Original strand, 14054210 - 14054260
Alignment:
| Q |
38 |
cccttttgcaaaacaccaattttgacttggtcaatcatatgtgtcacgcca |
88 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| | ||||||||| |||| |
|
|
| T |
14054210 |
cccttttgcaaaacaccaattttgacttgatcaaacctatgtgtcatgcca |
14054260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 38 - 96
Target Start/End: Original strand, 39688436 - 39688494
Alignment:
| Q |
38 |
cccttttgcaaaacaccaattttgacttggtcaatcatatgtgtcacgccagctgtgta |
96 |
Q |
| |
|
||||||||||| || ||||| ||||||||||||||| |||||||| ||||| ||||||| |
|
|
| T |
39688436 |
cccttttgcaatactccaatcttgacttggtcaatcctatgtgtctcgccacctgtgta |
39688494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 38 - 97
Target Start/End: Complemental strand, 26363559 - 26363500
Alignment:
| Q |
38 |
cccttttgcaaaacaccaattttgacttggtcaatcatatgtgtcacgccagctgtgtat |
97 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||| |||||||| ||||||| |||||||| |
|
|
| T |
26363559 |
cccttttgcaaaacgtcaattttgactcagtcaaccatatgtggcacgccacctgtgtat |
26363500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 38 - 88
Target Start/End: Original strand, 4376277 - 4376327
Alignment:
| Q |
38 |
cccttttgcaaaacaccaattttgacttggtcaatcatatgtgtcacgcca |
88 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||| | |||||||||||||| |
|
|
| T |
4376277 |
cccttttgcaaaacactaattttgaccgggtcaaacctatgtgtcacgcca |
4376327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 38 - 88
Target Start/End: Original strand, 35562335 - 35562385
Alignment:
| Q |
38 |
cccttttgcaaaacaccaattttgacttggtcaatcatatgtgtcacgcca |
88 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||| | ||||||||| |||| |
|
|
| T |
35562335 |
cccttttacaaaacatcaattttgacttggtcaaacctatgtgtcatgcca |
35562385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 38 - 71
Target Start/End: Original strand, 26830418 - 26830451
Alignment:
| Q |
38 |
cccttttgcaaaacaccaattttgacttggtcaa |
71 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
26830418 |
cccttttgcaaaaccccaattttgacttggtcaa |
26830451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 57; Significance: 6e-24; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 38 - 106
Target Start/End: Original strand, 40320505 - 40320573
Alignment:
| Q |
38 |
cccttttgcaaaacaccaattttgacttggtcaatcatatgtgtcacgccagctgtgtatattttgaat |
106 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40320505 |
cccttttgcaaaacatcaattttgacttggttaatcatatgtgtcacgccagctgtgtatatattgaat |
40320573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 38 - 88
Target Start/End: Original strand, 35959176 - 35959226
Alignment:
| Q |
38 |
cccttttgcaaaacaccaattttgacttggtcaatcatatgtgtcacgcca |
88 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||| | ||| |||||||||| |
|
|
| T |
35959176 |
cccttttgcaaaacactaattttgacttgatcaagcctatctgtcacgcca |
35959226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 38 - 71
Target Start/End: Original strand, 17352983 - 17353016
Alignment:
| Q |
38 |
cccttttgcaaaacaccaattttgacttggtcaa |
71 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
17352983 |
cccttttgcaaaactccaattttgacttggtcaa |
17353016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 39 - 107
Target Start/End: Complemental strand, 37918488 - 37918420
Alignment:
| Q |
39 |
ccttttgcaaaacaccaattttgacttggtcaatcatatgtgtcacgccagctgtgtatattttgaatt |
107 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| || ||||| |||| |||||||| |||| |||| |
|
|
| T |
37918488 |
ccttttgcaaaacctcaattttgatttggtcaatcctacatgtcatgccaactgtgtattttttaaatt |
37918420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 4e-22; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 42 - 107
Target Start/End: Complemental strand, 22778598 - 22778533
Alignment:
| Q |
42 |
tttgcaaaacaccaattttgacttggtcaatcatatgtgtcacgccagctgtgtatattttgaatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||||| |
|
|
| T |
22778598 |
tttgcaaaacaccaattttgacttggtcaatcctatgtgtcacgccagctgtgtattttctgaatt |
22778533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 38 - 107
Target Start/End: Original strand, 1531729 - 1531798
Alignment:
| Q |
38 |
cccttttgcaaaacaccaattttgacttggtcaatcatatgtgtcacgccagctgtgtatattttgaatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| ||||||||||| ||| ||||||| || |||||| |
|
|
| T |
1531729 |
cccttttgcaaaacaccaattttgacctggtcaatcctatgtgtcacgtcagttgtgtattttctgaatt |
1531798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 38 - 97
Target Start/End: Original strand, 31376623 - 31376682
Alignment:
| Q |
38 |
cccttttgcaaaacaccaattttgacttggtcaatcatatgtgtcacgccagctgtgtat |
97 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||| ||||||||||| |||| |||||||| |
|
|
| T |
31376623 |
cccttttgcaaaacctcaattttgactcagtcaaccatatgtgtcatgccacctgtgtat |
31376682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 71
Target Start/End: Original strand, 43914989 - 43915032
Alignment:
| Q |
28 |
ccatgtctatcccttttgcaaaacaccaattttgacttggtcaa |
71 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
43914989 |
ccatgtctaccccttttgcaaaacgtcaattttgacttggtcaa |
43915032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 14 - 80
Target Start/End: Complemental strand, 43916247 - 43916181
Alignment:
| Q |
14 |
tggcaaaagtaacaccatgtctatccc-ttttgcaaaacaccaattttgacttggtcaatcatatgtg |
80 |
Q |
| |
|
|||||||||| || ||||||||||||| ||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
43916247 |
tggcaaaagtgac-ccatgtctatccccttttgcaaaacgtcaattttgactcagtcaatcatatgtg |
43916181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 107
Target Start/End: Original strand, 29182379 - 29182457
Alignment:
| Q |
29 |
catgtctatcccttttgcaaaacaccaattttgacttggtcaatcatatgtgtcacgccagctgtgtatattttgaatt |
107 |
Q |
| |
|
|||||||| |||||||||||||| | |||||||||| ||||||| || |||||| | || |||||||| |||| |||| |
|
|
| T |
29182379 |
catgtctaccccttttgcaaaacgtcgattttgactttgtcaatcctacgtgtcatgtcaactgtgtatttttttaatt |
29182457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 4e-16; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 40 - 107
Target Start/End: Complemental strand, 21004608 - 21004541
Alignment:
| Q |
40 |
cttttgcaaaacaccaattttgacttggtcaatcatatgtgtcacgccagctgtgtatattttgaatt |
107 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||| ||| |||||||| ||||||||| |
|
|
| T |
21004608 |
cttttgcaaaacactaattttgacttggtcaatactatgtgtcacaccatctgtgtattttttgaatt |
21004541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 14 - 71
Target Start/End: Complemental strand, 3149212 - 3149155
Alignment:
| Q |
14 |
tggcaaaagtaacaccatgtctatcccttttgcaaaacaccaattttgacttggtcaa |
71 |
Q |
| |
|
|||||||||| || || ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3149212 |
tggcaaaagtgaccccgtgtctatcccttttgcaaaacgtcaattttgacttggtcaa |
3149155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 38 - 107
Target Start/End: Original strand, 30793940 - 30794009
Alignment:
| Q |
38 |
cccttttgcaaaacaccaattttgacttggtcaatcatatgtgtcacgccagctgtgtatattttgaatt |
107 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||| | ||||||||| |||| |||||||| |||| |||| |
|
|
| T |
30793940 |
cccttttgcaaaacatcaattttgacttagtcaaacctatgtgtcatgccaactgtgtattttttaaatt |
30794009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 38 - 88
Target Start/End: Complemental strand, 30796205 - 30796155
Alignment:
| Q |
38 |
cccttttgcaaaacaccaattttgacttggtcaatcatatgtgtcacgcca |
88 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||| | ||||||||| |||| |
|
|
| T |
30796205 |
cccttttgcaaaacaccgattttgacttagtcaaacctatgtgtcatgcca |
30796155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 38 - 83
Target Start/End: Complemental strand, 80973 - 80928
Alignment:
| Q |
38 |
cccttttgcaaaacaccaattttgacttggtcaatcatatgtgtca |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
80973 |
cccttttgcaaaacaccaattttgacttggtcaatcctatgtgtca |
80928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 38 - 107
Target Start/End: Complemental strand, 46171440 - 46171371
Alignment:
| Q |
38 |
cccttttgcaaaacaccaattttgacttggtcaatcatatgtgtcacgccagctgtgtatattttgaatt |
107 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||| |||| ||||||||| |||||||| || |||||| |
|
|
| T |
46171440 |
cccttttgcaaaacactaattttgacctggtcaatcctatgcgtcacgccaactgtgtattttctgaatt |
46171371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 14 - 64
Target Start/End: Original strand, 10614869 - 10614919
Alignment:
| Q |
14 |
tggcaaaagtaacaccatgtctatcccttttgcaaaacaccaattttgact |
64 |
Q |
| |
|
|||||||||| || ||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
10614869 |
tggcaaaagtgaccccatgtctaccccttttgcaaaacatcaattttgact |
10614919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 38 - 96
Target Start/End: Complemental strand, 22813251 - 22813193
Alignment:
| Q |
38 |
cccttttgcaaaacaccaattttgacttggtcaatcatatgtgtcacgccagctgtgta |
96 |
Q |
| |
|
|||||||| || || ||||| ||||||||||||||| |||||||| ||||| ||||||| |
|
|
| T |
22813251 |
cccttttgtaatactccaatcttgacttggtcaatcctatgtgtctcgccacctgtgta |
22813193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 38 - 83
Target Start/End: Original strand, 22099018 - 22099063
Alignment:
| Q |
38 |
cccttttgcaaaacaccaattttgacttggtcaatcatatgtgtca |
83 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||| ||||||||| |
|
|
| T |
22099018 |
cccttttgcaaaacaccaattttgatctggttaatcctatgtgtca |
22099063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 40 - 96
Target Start/End: Complemental strand, 21844321 - 21844265
Alignment:
| Q |
40 |
cttttgcaaaacaccaattttgacttggtcaatcatatgtgtcacgccagctgtgta |
96 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
21844321 |
cttttgcaaaatcccaattttgacttggtcaatcctatgtgtctcgccagctgtgta |
21844265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 14 - 102
Target Start/End: Original strand, 3488100 - 3488188
Alignment:
| Q |
14 |
tggcaaaagtaacaccatgtctatcccttttgcaaaacaccaattttgacttggtcaatcatatgtgtcacgccagctgtgtatatttt |
102 |
Q |
| |
|
|||||||||| || |||||| || || ||||||||||| |||||||||||| ||||||| || ||||| |||| |||||||| |||| |
|
|
| T |
3488100 |
tggcaaaagtgaccccatgtttaccctttttgcaaaacttcaattttgactttgtcaatcctacatgtcatgccaactgtgtatttttt |
3488188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 41 - 77
Target Start/End: Original strand, 19758338 - 19758374
Alignment:
| Q |
41 |
ttttgcaaaacaccaattttgacttggtcaatcatat |
77 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
19758338 |
ttttgtaaaacaccaattttaacttggtcaatcatat |
19758374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 38 - 88
Target Start/End: Complemental strand, 37023772 - 37023722
Alignment:
| Q |
38 |
cccttttgcaaaacaccaattttgacttggtcaatcatatgtgtcacgcca |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||| |||| |
|
|
| T |
37023772 |
cccttttgcaaaacaccaattttgacttggtcaaacctatgtgtcatgcca |
37023722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0151 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0151
Description:
Target: scaffold0151; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 86
Target Start/End: Complemental strand, 38326 - 38278
Alignment:
| Q |
38 |
cccttttgcaaaacaccaattttgacttggtcaatcatatgtgtcacgc |
86 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||| |||||||| ||||| |
|
|
| T |
38326 |
cccttttgcaaaacgtcaattttgacttagtcaaacatatgtggcacgc |
38278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University