View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3983_low_9 (Length: 275)

Name: NF3983_low_9
Description: NF3983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3983_low_9
NF3983_low_9
[»] chr1 (2 HSPs)
chr1 (186-258)||(14929385-14929457)
chr1 (77-130)||(14929510-14929563)


Alignment Details
Target: chr1 (Bit Score: 69; Significance: 5e-31; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 186 - 258
Target Start/End: Complemental strand, 14929457 - 14929385
Alignment:
186 ttacctatatgctttctgctccttgtaagatgagcctttaacttgcttacaatggaagcaagcttgacatcat 258  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
14929457 ttacctatatgctttctgctccttgtaagatgagcctttaatttgcttacaatggaagcaagcttgacatcat 14929385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 77 - 130
Target Start/End: Complemental strand, 14929563 - 14929510
Alignment:
77 tcaatgtatgtatgtttccaaataatgcattgaaaattcagtgtttgtagctcc 130  Q
    ||||||||||| ||||||||||||||||||| ||||||||||||||||| ||||    
14929563 tcaatgtatgtgtgtttccaaataatgcattaaaaattcagtgtttgtatctcc 14929510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University