View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3983_low_9 (Length: 275)
Name: NF3983_low_9
Description: NF3983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3983_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 69; Significance: 5e-31; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 186 - 258
Target Start/End: Complemental strand, 14929457 - 14929385
Alignment:
| Q |
186 |
ttacctatatgctttctgctccttgtaagatgagcctttaacttgcttacaatggaagcaagcttgacatcat |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14929457 |
ttacctatatgctttctgctccttgtaagatgagcctttaatttgcttacaatggaagcaagcttgacatcat |
14929385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 77 - 130
Target Start/End: Complemental strand, 14929563 - 14929510
Alignment:
| Q |
77 |
tcaatgtatgtatgtttccaaataatgcattgaaaattcagtgtttgtagctcc |
130 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
14929563 |
tcaatgtatgtgtgtttccaaataatgcattaaaaattcagtgtttgtatctcc |
14929510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University