View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3984_high_12 (Length: 236)
Name: NF3984_high_12
Description: NF3984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3984_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 62; Significance: 6e-27; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 27 - 121
Target Start/End: Original strand, 5497957 - 5498053
Alignment:
| Q |
27 |
aaaggaactgatgccgtagtatatctatttattctat--gttggttgaactttcaactcgatcatcgctattataatttgcatgtgtggattgttta |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| ||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
5497957 |
aaaggaactgatgccgtagtatatctatttattgtatctgttggttgaactttgcactcaatcatcggtattatactttgcatgtgtggattgttta |
5498053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 16 - 121
Target Start/End: Original strand, 5503010 - 5503125
Alignment:
| Q |
16 |
gtttggattggaaaggaactgatgcc--------gtagtatatctatttatt--ctatgttggttgaactttcaactcgatcatcgctattataatttgc |
105 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||||||||||| || ||||| ||||||||| ||||| |||| || ||||| ||||| |
|
|
| T |
5503010 |
gtttggattggaaaggaactgatgccatacagccgtagtacatctatttattgtctctgttgattgaactttgcactcggtcattactgttatactttgc |
5503109 |
T |
 |
| Q |
106 |
atgtgtggattgttta |
121 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
5503110 |
atgtgtggattgttta |
5503125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University