View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3984_low_13 (Length: 203)
Name: NF3984_low_13
Description: NF3984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3984_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 15 - 189
Target Start/End: Original strand, 38258924 - 38259098
Alignment:
| Q |
15 |
cagagatcacaaaaaggaaaacaaacaaccacacaaaaagacggatggagaaaatggttgaaatgaatctagtgtattttatgtcatgtatatgtatgga |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38258924 |
cagacatcacaaaaaggaaaacaaacaaccacacaaaaagacggatggagaaaatggttgaaatgaatctagtgtattttatgtcacgtatatgtatgga |
38259023 |
T |
|
| Q |
115 |
agaaggtgaaaactgaatagggtcttgtaatgcagggttggacactttatgagatactaaaatatgtgtctgaac |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38259024 |
agaaggtgaaaactgaatagggtcttgtaatgcagggttggacactttatgagatactaaaatatgtgcctgaac |
38259098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 61 - 189
Target Start/End: Original strand, 38238814 - 38238938
Alignment:
| Q |
61 |
ggagaaaatggttgaaatgaatctagtgtattttatgtcatgtatatgtatggaagaaggtgaaaactgaatagggtcttgtaatgcagggttggacact |
160 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||| ||| |||| |||||||||| |||||||||| |||||| | |||| |||||||||||||| |
|
|
| T |
38238814 |
ggagaagatggttgaattgaatctagtgtattttctgtattgta----aatggaagaagttgaaaactgattagggtttcataattcagggttggacact |
38238909 |
T |
|
| Q |
161 |
ttatgagatactaaaatatgtgtctgaac |
189 |
Q |
| |
|
|||||||||||| ||||||||| |||||| |
|
|
| T |
38238910 |
ttatgagatactgaaatatgtgcctgaac |
38238938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University