View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3985_high_13 (Length: 466)
Name: NF3985_high_13
Description: NF3985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3985_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-128; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-128
Query Start/End: Original strand, 134 - 450
Target Start/End: Original strand, 44546958 - 44547270
Alignment:
| Q |
134 |
ataattaatgtggaaagcttggtaatatgcaatcttatatttgtcaannnnnnnnnnnnctaatagtccacattttatctttcttttatgatgtgtatgt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44546958 |
ataattaatgtggaaagcttggtaatatgcaatcttaaatttgtcaatttttcttttttctaatagtccacattttatctttcttttatgatgtgtatgt |
44547057 |
T |
|
| Q |
234 |
actatctattcgaatgccattgcttccagtcagcccatcggtaaccgttggatcgagaccaaatggttcagatcttgatcccatctaacagttagcgatg |
333 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44547058 |
actat----tcgaatgtcattgcttccagtcagcccatcggtaaccgttggatcgagaccaaatggttcagatcttgatcccatctaacagttagcgatg |
44547153 |
T |
|
| Q |
334 |
caccgattgtgtgaatgtc-gggggctgtcgaggcaatttgcttttgtacttatttggttggatttgtatgcactcaagtcatatgcacgcagttggaac |
432 |
Q |
| |
|
||| ||||||||| ||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44547154 |
cactgattgtgtg-atgtcggggggctgtcaaggcaatttgcttttgtacttatttggttggatttgtatgcactcaagtcatatgcacgcagttggaac |
44547252 |
T |
|
| Q |
433 |
attggcaggcgttgaatc |
450 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
44547253 |
attggcaggcgttgaatc |
44547270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 19 - 69
Target Start/End: Original strand, 44546843 - 44546893
Alignment:
| Q |
19 |
gaacgatgtgaatgaggaagaaggtgtttcagctgtgaaagctacatttgt |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44546843 |
gaacgatgtgaatgaggaagaaggtgtttcagctgtgaaagctacatttgt |
44546893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University