View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3985_high_18 (Length: 334)
Name: NF3985_high_18
Description: NF3985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3985_high_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 18 - 326
Target Start/End: Original strand, 8181259 - 8181567
Alignment:
| Q |
18 |
ggattgacatcagtatggcagctgacactactcaccttggctgttgttccattcatagctatagcaggccgaacttacttaactattatatctactttat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8181259 |
ggattgacatcagtatggcagctgacactactcaccttggctgttgttccattcatagctatagcaggccgaacttacttaactattatatctactttat |
8181358 |
T |
|
| Q |
118 |
cggaaaaaggcaaagcagcttatgctgaagcagaaaaagttgctgaagaagtaatttctcgagtgcgtacagtttactcatttgcaggagaagaaaaagc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8181359 |
cggaaaaaggcaaagcagcttatgctgaagcagaaaaagttgctgaagaagtaatttctcgagtgcgtacagtttactcatttgcaggagaagaaaaagc |
8181458 |
T |
|
| Q |
218 |
tgttggttcatactcaaagtcgcttgataaggctttgaagcttggaaagaagagtggttttgcaaaaggtgttggagttggttttacatatgggctgtta |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8181459 |
tgttggttcatactcaaagtcgcttgataaggctttgaagcttggaaagaagagtggttttgcaaaaggtgttggagtcggttttacatatgggctgtta |
8181558 |
T |
|
| Q |
318 |
ttctgtgct |
326 |
Q |
| |
|
||||||||| |
|
|
| T |
8181559 |
ttctgtgct |
8181567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University