View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3985_high_43 (Length: 238)
Name: NF3985_high_43
Description: NF3985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3985_high_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 73 - 220
Target Start/End: Complemental strand, 46474297 - 46474149
Alignment:
| Q |
73 |
tattgtgctctatctcnnnnnnntattattgtaatgctacatttgtctaatctttttggtactctctcgatcctaaattataagtggccctataaaaaca |
172 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46474297 |
tattgtgctctatctcaaaaaaatattattgtaatgctacatttgtctaatctttttggtactctctcgatcctaaattataagtggccctttaaaaaca |
46474198 |
T |
 |
| Q |
173 |
attgttccaaattata-annnnnnnnacggtatcaacatgggcggttct |
220 |
Q |
| |
|
||| |||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
46474197 |
attcttccaaattatatatattttttacggtatcaacatgggcggttct |
46474149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 57
Target Start/End: Complemental strand, 46474322 - 46474284
Alignment:
| Q |
19 |
aataattattaaaatggtattgtaatattgtgctctatc |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46474322 |
aataattattaaaatggtattgtaatattgtgctctatc |
46474284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University