View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3985_low_20 (Length: 333)
Name: NF3985_low_20
Description: NF3985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3985_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 18 - 302
Target Start/End: Original strand, 49758441 - 49758726
Alignment:
| Q |
18 |
ctaaggcatggtacacgcaaactgaattgagtagacaaccattttctgctggccaaaatagagtatatgtttcaggagcctcaaagagagcgggatgatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
49758441 |
ctaaggcatggtacacgcaaactgaattgagtagacaacctttttctgctggcgaaaatagagtatatgtttcaggagcctcaaagagagcggtatgatg |
49758540 |
T |
 |
| Q |
118 |
gatcaattagaattctatccctttttcttaggccttcatcaattagtaagtcaaccaatttaacctggataccgcgag-tttnnnnnnnntaatcaacca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
49758541 |
gatcaattagaattctatccctttttcttaggccttcatcaattagtaagtcaaccaatttaacctggataccgcgagttttaaaaaaaataatcaacca |
49758640 |
T |
 |
| Q |
217 |
tttcatcttcatctaggacaatgggacgactccatattgaaggcataacttgtgccggcattcaaatgtcttctcatattttgaat |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
49758641 |
attcatcttcatctaggacaatgggacgactccatattgaaggcataacttgtgccggcattcaaatgtcttttgatattttgaat |
49758726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University