View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3985_low_33 (Length: 289)
Name: NF3985_low_33
Description: NF3985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3985_low_33 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 45 - 279
Target Start/End: Complemental strand, 38796275 - 38796041
Alignment:
| Q |
45 |
ctttgaagacggagaatctagctttgacaatgtttagcaaaatgagagtttcacgcattcatccactctttgattaatcacagaactgaaattaactggc |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38796275 |
ctttgaagacggagaatctagctttgacaatgtttagcaaaatgagagtttcacacattcatccactctttgattaatcacagaactgaaattaactggc |
38796176 |
T |
|
| Q |
145 |
atcgatgcatgaacnnnnnnntgctcccactctttgatttcacatttctctagtgcagcaacaattttcgtcctttctctttcatttggaaataacagtt |
244 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38796175 |
atcgatgcatgaacaaaaaaatgctcccactctttgatttcacatttctctagtgcagcaacaattttcgtcctttctctttcatttggaaataacagtt |
38796076 |
T |
|
| Q |
245 |
tggtaatacttttgtttttagttttgcagttcatc |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
38796075 |
tggtaatacttttgtttttagttttgcagttcatc |
38796041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 167 - 237
Target Start/End: Complemental strand, 38423719 - 38423649
Alignment:
| Q |
167 |
gctcccactctttgatttcacatttctctagtgcagcaacaattttcgtcctttctctttcatttggaaat |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
38423719 |
gctcccactctttgatttcacatttctctagtgcagtaacaattttcgtcctctctctttcatttggaaat |
38423649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 26 - 87
Target Start/End: Complemental strand, 38425109 - 38425048
Alignment:
| Q |
26 |
aattgttccagcggtatgcctttgaagacggagaatctagctttgacaatgtttagcaaaat |
87 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
38425109 |
aattgctccagcggtatgcctttgaagacggagaatctagctttgacaatgctttgcaaaat |
38425048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University