View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3985_low_38 (Length: 266)
Name: NF3985_low_38
Description: NF3985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3985_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 63 - 163
Target Start/End: Complemental strand, 11532150 - 11532051
Alignment:
| Q |
63 |
tgaatactaacaaaaatatgagcaaattaaaatgatttgtaatgtgaaaagagatagagtagagctgaattgttggtttcgtagagtttaaatatcttat |
162 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11532150 |
tgaatactaacaaaaatatgagcaa-ttaaaatgatttgtaatgtgaaaagagatagagtagagctgaattgttggtttcgtagagtttaaatatcttat |
11532052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 36 - 163
Target Start/End: Original strand, 11454640 - 11454766
Alignment:
| Q |
36 |
tccatgtttcatgtgcgcgcnnnnnnntgaatactaacaaaaatatgagcaaattaaaatgatttgtaatgtgaaaagagatagagtagagctgaattgt |
135 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11454640 |
tccatgtttcatgtgcgcgcaaaaaaatgaatactaacaaatatatgaacaaattaaa-tgatttgtaatgtgaaaagagatagagtagagctgaattgt |
11454738 |
T |
 |
| Q |
136 |
tggtttcgtagagtttaaatatcttata |
163 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
11454739 |
tggtttcgtagagtttaaatatcttata |
11454766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 78 - 144
Target Start/End: Original strand, 11493856 - 11493921
Alignment:
| Q |
78 |
atatgagcaaattaaaatgatttgtaatgtgaaaagagatagagtagagctgaattgttggtttcgt |
144 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
11493856 |
atatgagcaaattaaa-taatttgtaatgtgaaaagagatagagtagagatggattgttggtttcgt |
11493921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University