View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3985_low_39 (Length: 263)
Name: NF3985_low_39
Description: NF3985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3985_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 11 - 226
Target Start/End: Original strand, 31584116 - 31584331
Alignment:
| Q |
11 |
atatatgtaaacaatacttatatttctatcatatcatgcaagaatatatgtacgtgtatgtgtgtaatttaagtaatattgtaacnnnnnnnggnnnnnn |
110 |
Q |
| |
|
|||||| |||||||||||| ||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
31584116 |
atatatctaaacaatacttctatttatatcttatcatgcaagaatatatgtacgtgtatgtgtgtaatttaagtaatattgtaactttttctcggaaaaa |
31584215 |
T |
 |
| Q |
111 |
ngtattgcaaattttaaatagataacacttatacgcatgttccattatggccagcccaaacattcaaactatttaacatttggatcatcccaattcgaac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31584216 |
aatattgcaaattttaaatagataacacttgtacgcatgttccattatcgccagcccaaacattcaaactatttaacatttggatcatcccaattcgaac |
31584315 |
T |
 |
| Q |
211 |
atccttcattttcaat |
226 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
31584316 |
atccttcattttcaat |
31584331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 46 - 90
Target Start/End: Original strand, 31582281 - 31582325
Alignment:
| Q |
46 |
atgcaagaatatatgtacgtgtatgtgtgtaatttaagtaatatt |
90 |
Q |
| |
|
||||| |||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
31582281 |
atgcatgaatatgtgtacgtgtatgtgtgtagtttaagtaatatt |
31582325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University