View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3985_low_40 (Length: 256)
Name: NF3985_low_40
Description: NF3985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3985_low_40 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 19 - 256
Target Start/End: Complemental strand, 9567210 - 9566972
Alignment:
| Q |
19 |
atgaactgttcggaaagtggaaggcaagattttcaatggcaggttttgtaccgttactgttgagtccatcggtgattgattcagttagaactctcttgaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9567210 |
atgaactgttcggaaagtggaaggcaagattttcaatggcaggttttgtaccgttactgttgagtccatcggtgattgattcagtcagaactctcttgaa |
9567111 |
T |
|
| Q |
119 |
agatttcaataaagattataggattgaacaaacagatgttgctatcaatttagcgtggaagagtaaagttatgtgcacatcttctgcttggagatgttat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9567110 |
agatttcaataaagattataggattgaacaaacagatgttgctatcaatttagcgtggaagagtaaagttatgtgcacatcttctgcttggagatgttat |
9567011 |
T |
|
| Q |
219 |
tgac-gggccgactcgagacaagatgaggcttaaagtta |
256 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
9567010 |
tgacagggccgactcgacacaagatgaggcttaaagtta |
9566972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University