View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3985_low_44 (Length: 247)
Name: NF3985_low_44
Description: NF3985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3985_low_44 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 38 - 174
Target Start/End: Original strand, 38422647 - 38422785
Alignment:
| Q |
38 |
gcctatgttccaaaatagattgaagtatgtatgtgaatagaaacatcatctgattagttattagttatataattgttagggag--catgaggaaataatg |
135 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | |||| ||||||| || |
|
|
| T |
38422647 |
gcctatgttccaaaatagattggagtatgtatgtcaatagaaacatcatctgattagttattagttatataattgttaggggggccatggggaaatagtg |
38422746 |
T |
 |
| Q |
136 |
gacacattagtgacctagagaggaaataaaccccaggtt |
174 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
38422747 |
gacacattagtgacctagaaaggaaataaacccaaggtt |
38422785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 155 - 209
Target Start/End: Original strand, 32194842 - 32194896
Alignment:
| Q |
155 |
gaggaaataaaccccaggtttggaatgtatatcatagtaaacgtttcaaggggca |
209 |
Q |
| |
|
||||||||| |||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32194842 |
gaggaaatagaccccatttttggaatgtttatcatagtaaacgtttcaaggggca |
32194896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 155 - 209
Target Start/End: Original strand, 20362650 - 20362704
Alignment:
| Q |
155 |
gaggaaataaaccccaggtttggaatgtatatcatagtaaacgtttcaaggggca |
209 |
Q |
| |
|
||||||||| |||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
20362650 |
gaggaaatagaccccatttttggaatgtttatcatagtaaacgtttcaaggggca |
20362704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 155 - 209
Target Start/End: Original strand, 21550365 - 21550419
Alignment:
| Q |
155 |
gaggaaataaaccccaggtttggaatgtatatcatagtaaacgtttcaaggggca |
209 |
Q |
| |
|
||||||||| |||||| |||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
21550365 |
gaggaaatagaccccatttttggaatgtttatcttagtaaacgtttcaaggggca |
21550419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University