View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3986_high_4 (Length: 244)
Name: NF3986_high_4
Description: NF3986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3986_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 18 - 234
Target Start/End: Complemental strand, 49921710 - 49921494
Alignment:
| Q |
18 |
gttaacacaacggtgaatccttggcacctttttgcacccattatcagcaatataaaggacctgatgactcacgattggcatttacaactgagtcatacgt |
117 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
49921710 |
gttaacacaatggtgaatccttgacacctttttgcacccattatcagcaatataaaggacctgatggctcgcgattggcatttacaactgagtcatacgt |
49921611 |
T |
 |
| Q |
118 |
ggcgggaggcgaatgccacgactgatttcatggcgaagatgggcgcgaactataacgaagcttggcaggagtttgtagaaccacctgatggtatcttgcc |
217 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49921610 |
ggcgggaggcgaatgccacagctgatttcatggcgaagatgggcgcgaactgtaacgaagcttggcaggagtttgtagaaccacctgatggtatcttgcc |
49921511 |
T |
 |
| Q |
218 |
tcttctgcatgatgatg |
234 |
Q |
| |
|
||| ||||| ||||||| |
|
|
| T |
49921510 |
tctgctgcaggatgatg |
49921494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 29 - 160
Target Start/End: Original strand, 13799758 - 13799889
Alignment:
| Q |
29 |
ggtgaatccttggcacctttttgcacccattatcagcaatataaaggacctgatgactcacgattggcatttacaactgagtcatacgtggcgggaggcg |
128 |
Q |
| |
|
||||||| |||||||||| |||||||| ||||||||||||| ||||| || ||| ||| ||| ||| |||| |||||||||||||||||| ||||||| |
|
|
| T |
13799758 |
ggtgaattcttggcacctctttgcacctgttatcagcaatatcaaggatctaatggctcgcgactggaatttccaactgagtcatacgtggtgggaggca |
13799857 |
T |
 |
| Q |
129 |
aatgccacgactgatttcatggcgaagatggg |
160 |
Q |
| |
|
||||| || |||||||||||| ||||||||| |
|
|
| T |
13799858 |
aatgctacagctgatttcatggtgaagatggg |
13799889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University