View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3986_high_5 (Length: 238)
Name: NF3986_high_5
Description: NF3986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3986_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 14 - 223
Target Start/End: Original strand, 45594605 - 45594810
Alignment:
| Q |
14 |
ctttcttttccttctagatagacatatacactcagctaccagtccttataacaccttcttccagctgaatttgtttcagattgtgttatgagtcattctt |
113 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45594605 |
ctttcttttccttctaga----catatacactcagctaccagtccttataacaccttcttccagctgaatttgtttcagattgtgttatgagtcattctt |
45594700 |
T |
|
| Q |
114 |
tcaccaatgtgttaacttgtgaaggaaaaagcttttgctttaacttgagtaggctttttatactgtaggtggtgattctttccgacataaacaatcaggt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45594701 |
tcaccaatgtgttaacttgtgaaggaaaatgcttttgctttaacttgagtaggctttttatactgtaggtggtgattctttacgacataaacaatcaggt |
45594800 |
T |
|
| Q |
214 |
aaaggatttg |
223 |
Q |
| |
|
|||||||||| |
|
|
| T |
45594801 |
aaaggatttg |
45594810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University