View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3987_low_3 (Length: 214)

Name: NF3987_low_3
Description: NF3987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3987_low_3
NF3987_low_3
[»] chr4 (1 HSPs)
chr4 (29-193)||(38540858-38541022)


Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 29 - 193
Target Start/End: Complemental strand, 38541022 - 38540858
Alignment:
29 aaaccgatagacatttgcatagttttttaaagtaatcatataataaaacataaaattcactaaattgtattaggtaaattataattctagtaaatgtaca 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38541022 aaaccgatagacatttgcatagttttttaaagtaatcatataataaaacataaaattcactaaattgtattaggtaaattataattctagtaaatgtaca 38540923  T
129 tgttgaaaataaaataagaattgcaatgtgtaggagtagtactagagaacattatatcgagagag 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
38540922 tgttgaaaataaaataagaattgcaatgtgtaggagtagtactagagaccattatatcgagagag 38540858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University