View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3989_high_11 (Length: 214)
Name: NF3989_high_11
Description: NF3989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3989_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 52947672 - 52947557
Alignment:
| Q |
1 |
ttacaccatgactctttagcttctctgaaaccctatttcacaaggacgaaatgcaaaaatgaaaaca--ttttttcaataaataggggggaaatcaaaag |
98 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||||||||||| ||||||| | || ||||||||||||||||||||||||||||||| |
|
|
| T |
52947672 |
ttacaccatgactctctaacttctctgaaaccctatttcacaaggacgaaatg-gaaaatgagagcattttttttcaataaataggggggaaatcaaaag |
52947574 |
T |
|
| Q |
99 |
acatgatgactcaccaa |
115 |
Q |
| |
|
||| ||||||||||||| |
|
|
| T |
52947573 |
acaggatgactcaccaa |
52947557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University