View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3991_high_12 (Length: 330)
Name: NF3991_high_12
Description: NF3991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3991_high_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 243 - 315
Target Start/End: Complemental strand, 25619832 - 25619760
Alignment:
| Q |
243 |
gattgaatttttaggtataccagttgtttagcttggagagtggagggtagaacaagcttgtgaaatgaaggag |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25619832 |
gattgaatttttaggtataccagttgtttagcttggagagtggagggtagaacaagcttgtgaaatgaaggag |
25619760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 30 - 81
Target Start/End: Complemental strand, 25620036 - 25619985
Alignment:
| Q |
30 |
tttaaacttgatgaaagggatgacagggtttgagggttgtggatgatgggtg |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25620036 |
tttaaacttgatgaaagggatgacagggtttgagggttgtggatgatgggtg |
25619985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 108 - 154
Target Start/End: Complemental strand, 25619958 - 25619912
Alignment:
| Q |
108 |
ttatcaaaccctttattcactatcaaaattctcataaacccactacc |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25619958 |
ttatcaaaccctttattcactatcaaaattctcataaacccactacc |
25619912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University