View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3991_high_24 (Length: 236)
Name: NF3991_high_24
Description: NF3991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3991_high_24 |
 |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 10)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 30220295 - 30220515
Alignment:
| Q |
1 |
cttggtgatggttactctctcatgggtgctcttctttcttgtctacaaagagctgatgatccttctcttcctctatcttttccttcacgaccacaattaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30220295 |
cttggtgatggttactctctcatgggtgctcttctttcttgtcttcaaagagctgatgatccttctcttcctctatcttttccttcacgaccacaattaa |
30220394 |
T |
 |
| Q |
101 |
attcaaaatatgcaaagaaaggtttgtttaagaagttatgtttagatatctcatccttttttagctccatatcagattttggatcaagcttaatcaagac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30220395 |
attcaaaatatgcaaagaaaggtttgtttaagaagttatgtttagatatctcatccttttttagctccatatcagattttggatcaagcttaatcaagac |
30220494 |
T |
 |
| Q |
201 |
aagaatgattgaagatgacaa |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
30220495 |
aagaatgattgaagatgacaa |
30220515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 30048630 - 30048407
Alignment:
| Q |
1 |
cttggtgatggttactctctcatgggtgctcttctttcttgtctacaaagagctgatgatccttctcttcctctatcttttccttcac---gaccacaat |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30048630 |
cttggtgatggttactctctcatgggtgctcttctttcttgtcttcaaagagctgatgatccttctcttcctctatcttttccttcaaaaagaccacaat |
30048531 |
T |
 |
| Q |
98 |
taaattcaaaatatgcaaagaaaggtttgtttaagaagttatgtttagatatctcatccttttttagctccatatcagattttggatcaagcttaatcaa |
197 |
Q |
| |
|
|| |||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || | || |
|
|
| T |
30048530 |
tagattcaaaatatgcaaagaaaagtttgtttaagaagttatgtatagatatctcatccttttttagctccatatcagattttggatcaagcatattgaa |
30048431 |
T |
 |
| Q |
198 |
gacaagaatgattgaagatgacaa |
221 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
30048430 |
gacaacaatgattgaagatgacaa |
30048407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 30062971 - 30062748
Alignment:
| Q |
1 |
cttggtgatggttactctctcatgggtgctcttctttcttgtctacaaagagctgatgatccttctcttcctctatcttttccttcac---gaccacaat |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30062971 |
cttggtgatggttactctctcatgggtgctcttctttcttgtcttcaaagagctgatgatccttctcttcctctatcttttccttcaaaaagaccacaat |
30062872 |
T |
 |
| Q |
98 |
taaattcaaaatatgcaaagaaaggtttgtttaagaagttatgtttagatatctcatccttttttagctccatatcagattttggatcaagcttaatcaa |
197 |
Q |
| |
|
|| |||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || | || |
|
|
| T |
30062871 |
tagattcaaaatatgcaaagaaaagtttgtttaagaagttatgtatagatatctcatccttttttagctccatatcagattttggatcaagcatattgaa |
30062772 |
T |
 |
| Q |
198 |
gacaagaatgattgaagatgacaa |
221 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
30062771 |
gacaacaatgattgaagatgacaa |
30062748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 30228769 - 30228546
Alignment:
| Q |
1 |
cttggtgatggttactctctcatgggtgctcttctttcttgtctacaaagagctgatgatccttctcttcctctatcttttccttcac---gaccacaat |
97 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30228769 |
cttggtgatggttactctctcatgagtgctcttctttcttgtcttcaaagagctgatgatccttctcttcctctatcttttccttcacaaagaccacaat |
30228670 |
T |
 |
| Q |
98 |
taaattcaaaatatgcaaagaaaggtttgtttaagaagttatgtttagatatctcatccttttttagctccatatcagattttggatcaagcttaatcaa |
197 |
Q |
| |
|
||||||||||||||||||||| | || ||| ||||| ||||||| | ||||||||||||||||||||||||||||||||||||||||||| || | || |
|
|
| T |
30228669 |
taaattcaaaatatgcaaagataaacttatttgagaagctatgttttgttatctcatccttttttagctccatatcagattttggatcaagcatattgaa |
30228570 |
T |
 |
| Q |
198 |
gacaagaatgattgaagatgacaa |
221 |
Q |
| |
|
||||||||||||| |||||||||| |
|
|
| T |
30228569 |
gacaagaatgattaaagatgacaa |
30228546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 30032384 - 30032161
Alignment:
| Q |
1 |
cttggtgatggttactctctcatgggtgctcttctttcttgtctacaaagagctgatgatccttctcttcctctatcttttccttcac---gaccacaat |
97 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
30032384 |
cttggtgacggttactctctcatgggtgctcttctttcttgtcttcaaagagctgatgatccttctcttcctttatcttttccttcacaaagaccacaat |
30032285 |
T |
 |
| Q |
98 |
taaattcaaaatatgcaaagaaaggtttgtttaagaagttatgtttagatatctcatccttttttagctccatatcagattttggatcaagcttaatcaa |
197 |
Q |
| |
|
|| |||||||||||||||| | | || ||||||||| |||| || |||||||| |||||||| ||||||||||||||||||||||||||| |||| || |
|
|
| T |
30032284 |
tagattcaaaatatgcaaaaataaacttatttaagaagctatgctttgatatctcctcctttttcagctccatatcagattttggatcaagcataattaa |
30032185 |
T |
 |
| Q |
198 |
gacaagaatgattgaagatgacaa |
221 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
30032184 |
gacaagaatgattgaagatgacaa |
30032161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 30271326 - 30271238
Alignment:
| Q |
1 |
cttggtgatggttactctctcatgggtgctcttctttcttgtctacaaagagctgatgatccttctcttcctctatcttttccttcacg |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | |||||||||||||| |
|
|
| T |
30271326 |
cttggtgatggttactctctcatgggtgctcttctttcttgtctacaaagagctgatgacccttctcttcctttgtcttttccttcacg |
30271238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 30280863 - 30280951
Alignment:
| Q |
1 |
cttggtgatggttactctctcatgggtgctcttctttcttgtctacaaagagctgatgatccttctcttcctctatcttttccttcacg |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | |||||||||||||| |
|
|
| T |
30280863 |
cttggtgatggttactctctcatgggtgctcttctttcttgtctacaaagagctgatgacccttctcttcctttgtcttttccttcacg |
30280951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 30304393 - 30304305
Alignment:
| Q |
1 |
cttggtgatggttactctctcatgggtgctcttctttcttgtctacaaagagctgatgatccttctcttcctctatcttttccttcacg |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| | |||||||||||||| |
|
|
| T |
30304393 |
cttggtgatggttactctctcatgggtgctcttctttcttgtctacaaagagttgatgacccttctcttcctttgtcttttccttcacg |
30304305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 30264432 - 30264349
Alignment:
| Q |
1 |
cttggtgatggttactctctcatgggtgctcttctttcttgtctacaaagagctgatgatccttctcttcctctatcttttcct |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| | ||||||||| |
|
|
| T |
30264432 |
cttggtgatggttactctctcatgggtgctcttctttcttgtcttcatagagctgatgatccttctcttcctttgtcttttcct |
30264349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 30287756 - 30287839
Alignment:
| Q |
1 |
cttggtgatggttactctctcatgggtgctcttctttcttgtctacaaagagctgatgatccttctcttcctctatcttttcct |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| | ||||||||| |
|
|
| T |
30287756 |
cttggtgatggttactctctcatgggtgctcttctttcttgtcttcatagagctgatgatccttctcttcctttgtcttttcct |
30287839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 2311405 - 2311490
Alignment:
| Q |
1 |
cttggtgatggttactctctcatgggtgctcttctttcttgtctacaaagagctgatgatccttctcttcctctatcttttccttc |
86 |
Q |
| |
|
||||| |||||||| ||||| |||||||| |||||||||||||||||| | ||||||||||| ||||||||| | ||||||||||| |
|
|
| T |
2311405 |
cttggagatggttattctctaatgggtgcacttctttcttgtctacaacgtgctgatgatccatctcttcctttgtcttttccttc |
2311490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 79604 - 79534
Alignment:
| Q |
1 |
cttggtgatggttactctctcatgggtgctcttctttcttgtctacaaagagctgatgatccttctcttcc |
71 |
Q |
| |
|
||||| |||||||||||||| |||||||| |||||||| ||| || ||||||||||| | ||||||||||| |
|
|
| T |
79604 |
cttggagatggttactctctaatgggtgcacttctttcatgtttagaaagagctgataacccttctcttcc |
79534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 72540 - 72470
Alignment:
| Q |
1 |
cttggtgatggttactctctcatgggtgctcttctttcttgtctacaaagagctgatgatccttctcttcc |
71 |
Q |
| |
|
||||| |||||||||||||| ||||| |||||||| || ||| || ||||||||||| | |||| |||||| |
|
|
| T |
72540 |
cttggagatggttactctctaatgggagctcttctatcatgtttagaaagagctgataacccttttcttcc |
72470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University