View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3991_low_14 (Length: 330)

Name: NF3991_low_14
Description: NF3991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3991_low_14
NF3991_low_14
[»] chr4 (3 HSPs)
chr4 (243-315)||(25619760-25619832)
chr4 (30-81)||(25619985-25620036)
chr4 (108-154)||(25619912-25619958)


Alignment Details
Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 243 - 315
Target Start/End: Complemental strand, 25619832 - 25619760
Alignment:
243 gattgaatttttaggtataccagttgtttagcttggagagtggagggtagaacaagcttgtgaaatgaaggag 315  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25619832 gattgaatttttaggtataccagttgtttagcttggagagtggagggtagaacaagcttgtgaaatgaaggag 25619760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 30 - 81
Target Start/End: Complemental strand, 25620036 - 25619985
Alignment:
30 tttaaacttgatgaaagggatgacagggtttgagggttgtggatgatgggtg 81  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
25620036 tttaaacttgatgaaagggatgacagggtttgagggttgtggatgatgggtg 25619985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 108 - 154
Target Start/End: Complemental strand, 25619958 - 25619912
Alignment:
108 ttatcaaaccctttattcactatcaaaattctcataaacccactacc 154  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
25619958 ttatcaaaccctttattcactatcaaaattctcataaacccactacc 25619912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University