View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3991_low_18 (Length: 293)
Name: NF3991_low_18
Description: NF3991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3991_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 25 - 288
Target Start/End: Original strand, 42210060 - 42210327
Alignment:
| Q |
25 |
tatgtcaatttatatcaacgattgcgtgattgtgtgaatatttcaaaaccataagctacaaactgtagatgtgttcataacatgtcctgaggtaaagcat |
124 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42210060 |
tatgccaatttatatcaacgattgcgtgattgtgtgaatatttcaaaaccataagctacaaactgtagatgtgttcataacatgtcctgagggaaagcat |
42210159 |
T |
 |
| Q |
125 |
caatgagatgatttttcaaaatttaagaaaacattaaagtaaaaatggtgggggttagaggatgaatcgtataattaggctaatgcaagaattctcatat |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42210160 |
caatgagatgatttttcaaaatttaagaaaacattaaagtaaaaatggtgggggttagaggatgaatcgtataattaggctaatgcaagaattctcatat |
42210259 |
T |
 |
| Q |
225 |
c----atataaaaataaaaatggtgtcttttgtctcttcttttgaatgttatggggtcctttgcttct |
288 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
42210260 |
catatatataaaaataaaaatggtgtcttttgtctcttcttttgaatgttatggggtcccttgattct |
42210327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University