View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3991_low_20 (Length: 278)
Name: NF3991_low_20
Description: NF3991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3991_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 135 - 267
Target Start/End: Complemental strand, 12396920 - 12396787
Alignment:
| Q |
135 |
gtgtttttgtaagaaaaagattaaacaatgtttaattattcatttaatccttcaactataagaaactttgatttaatc-ttgataattctttctttttgt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12396920 |
gtgtttttgtaagaaaaagattaaacaatgtttaattattcatttaatccttcaactataaaaaactttgatttaatctttgataattctttctttttgt |
12396821 |
T |
 |
| Q |
234 |
ccttgtaatctctaaaccatcacttttggtctct |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
12396820 |
ccttgtaatctctaaaccatcacttttggtctct |
12396787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 19 - 98
Target Start/End: Complemental strand, 12397036 - 12396957
Alignment:
| Q |
19 |
actagtaatatataannnnnnnaagaagcaaaactaacatatttaaattgacgttggagagaatcgaaacagagactttg |
98 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
12397036 |
actagtaatatataatttttttaagaagcaaaactagcatatttaaattgacgttggagagaaccgaaatagagactttg |
12396957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University