View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3991_low_9 (Length: 427)
Name: NF3991_low_9
Description: NF3991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3991_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 2e-81; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 2e-81
Query Start/End: Original strand, 20 - 177
Target Start/End: Original strand, 42003409 - 42003566
Alignment:
| Q |
20 |
ttcagctggtgtgtcggagaagtcaaatgtttttctctccggggccaataaggttggagaaactgaatcatttccatggaacaatactatgttgtcgtgg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42003409 |
ttcagctggtgtgtcggagaagtcaaatgtttttctctccgggcccaataaggttggagaaactgaatcatttccatggaacaatactatgttgtcgtgg |
42003508 |
T |
 |
| Q |
120 |
cagagaacatcttttcattttcaaccagagaagaattggatgaatggtaattccatgc |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42003509 |
cagagaacatcttttcattttcaaccagagaagaattggatgaatggtaattccatgc |
42003566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 219 - 415
Target Start/End: Original strand, 42003624 - 42003830
Alignment:
| Q |
219 |
gagaattacagattcaaacgtacgtctcaatggtcttgccacctaccaattgattacgagactagatttaaatcgatagttatgatttttgttttgaaac |
318 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42003624 |
gagaattacagattcaaacgtacgtcttaacggtcttgccacttaccaattgattacgagactagatttaaatcgatagttatgatttttgttttgaaac |
42003723 |
T |
 |
| Q |
319 |
gtagtggttaggttaatattt----------gataatttgaatctggtctttcaactctttattattagttcaaactagttgaattacttaacacattta |
408 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42003724 |
gtagtggttaggttaatattttctattttaccataatttgaatctaatctttcaactctttattattagttcaaaccagttgaattacttaacacattta |
42003823 |
T |
 |
| Q |
409 |
atcgttc |
415 |
Q |
| |
|
||||||| |
|
|
| T |
42003824 |
atcgttc |
42003830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University