View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3992_high_60 (Length: 243)
Name: NF3992_high_60
Description: NF3992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3992_high_60 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 25306237 - 25306101
Alignment:
| Q |
1 |
tagggaattatccgaatttgtgtttggtgagccgttttccggtgaatcaaccctttaagatgaaacccatgaaggtgtgtatgcctgaagtgtggcggct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
25306237 |
tagggaattatccgaatttgtgtttggtgaggcgttttccggtgaatcaaccctttaagatgaaacccatgaaggtgtgtatgcctgaagtgtggcggat |
25306138 |
T |
 |
| Q |
101 |
gatgaaggttgtgccggtaaaggagactttccttggt |
137 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
25306137 |
gatgaaggttgtggcagtaaaggagactttccttggt |
25306101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 136 - 229
Target Start/End: Complemental strand, 25304630 - 25304537
Alignment:
| Q |
136 |
gtgtatcatataagactttaatgatgttgtatctcaacaagataagcttggagtccatgcacatccaaattggttgtgtaatggattttgtgaa |
229 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25304630 |
gtgtatcatataagactttaatgaccttgtatctcaacaagataagcttcgagtccatgcacatccaaattggttgtgtaatggattttgtgaa |
25304537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University