View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3992_high_64 (Length: 237)

Name: NF3992_high_64
Description: NF3992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3992_high_64
NF3992_high_64
[»] chr6 (1 HSPs)
chr6 (123-221)||(16343403-16343503)


Alignment Details
Target: chr6 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 123 - 221
Target Start/End: Complemental strand, 16343503 - 16343403
Alignment:
123 catcctgtttttcgtaacctgatagatttcactaaactttagttt-ctttataactcgatagttttgagaatc-ttaatatttttcattttgacaagttt 220  Q
    ||||||||||||| |||| | ||||||| |||||||||| ||||| ||||||||||||||||||||||||||| |||||||||||||| |||||||||||    
16343503 catcctgtttttcctaacttcatagattacactaaacttcagttttctttataactcgatagttttgagaatctttaatatttttcatattgacaagttt 16343404  T
221 t 221  Q
    |    
16343403 t 16343403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University