View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3992_high_68 (Length: 212)

Name: NF3992_high_68
Description: NF3992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3992_high_68
NF3992_high_68
[»] chr6 (2 HSPs)
chr6 (132-207)||(3765469-3765544)
chr6 (67-115)||(3762689-3762737)


Alignment Details
Target: chr6 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 132 - 207
Target Start/End: Original strand, 3765469 - 3765544
Alignment:
132 atcactcggatggacctgatttcctcagatgtccatgtttcaatcacctttcagaggcgttagttcctttgcttct 207  Q
    ||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||| ||| ||||    
3765469 atcactcggatggacctgattccctcatatgtcaatgtttcaatcacctttcagaggcgttagttcccttggttct 3765544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 67 - 115
Target Start/End: Original strand, 3762689 - 3762737
Alignment:
67 aagaatgtgattggttctcaaattgtaattggtcctcatagtggagaat 115  Q
    |||||||||||| || |||||||||||||||||||||||||||||||||    
3762689 aagaatgtgattagtgctcaaattgtaattggtcctcatagtggagaat 3762737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University