View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3992_high_68 (Length: 212)
Name: NF3992_high_68
Description: NF3992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3992_high_68 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 132 - 207
Target Start/End: Original strand, 3765469 - 3765544
Alignment:
| Q |
132 |
atcactcggatggacctgatttcctcagatgtccatgtttcaatcacctttcagaggcgttagttcctttgcttct |
207 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
3765469 |
atcactcggatggacctgattccctcatatgtcaatgtttcaatcacctttcagaggcgttagttcccttggttct |
3765544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 67 - 115
Target Start/End: Original strand, 3762689 - 3762737
Alignment:
| Q |
67 |
aagaatgtgattggttctcaaattgtaattggtcctcatagtggagaat |
115 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
3762689 |
aagaatgtgattagtgctcaaattgtaattggtcctcatagtggagaat |
3762737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University