View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3992_low_17 (Length: 444)
Name: NF3992_low_17
Description: NF3992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3992_low_17 |
 |  |
|
| [»] scaffold0562 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (4 HSPs) |
 |  |  |
|
| [»] scaffold0106 (2 HSPs) |
 |  |  |
|
| [»] scaffold0517 (2 HSPs) |
 |  |  |
|
| [»] scaffold0230 (1 HSPs) |
 |  |  |
|
| [»] scaffold0001 (2 HSPs) |
 |  |  |
|
| [»] scaffold0095 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 91; Significance: 6e-44; HSPs: 30)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 29 - 172
Target Start/End: Complemental strand, 41847327 - 41847180
Alignment:
| Q |
29 |
atcattgtcccctaagcatagttgatagaaataatacaatgtaacatggggttcaaattttagatcacctatgt----cttcattttaggctaaaatatg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
41847327 |
atcattgtcccctaagcatagttgatagaaataatacaatgtaatatggggttcaatttttcgatcacctatgtattcattcattttaggctaaaatatg |
41847228 |
T |
 |
| Q |
125 |
tttttaatccctacaaatatagcgagtttgggttttggtccctgataa |
172 |
Q |
| |
|
||||| || || |||||||||||| |||| ||||||||||||||||| |
|
|
| T |
41847227 |
cttttagtctctgcaaatatagcgaatttgagttttggtccctgataa |
41847180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 231 - 306
Target Start/End: Complemental strand, 14712719 - 14712644
Alignment:
| Q |
231 |
cccactttcttgcttatttggcaggtttttgcttagatgtcacttgctgactgtatcattttgtacacgtggattt |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14712719 |
cccactttcttgcttatttggcaggtttttgcttaggtgtcacttgctgactgtatcattttgtacatgtggattt |
14712644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 216 - 306
Target Start/End: Complemental strand, 41847133 - 41847043
Alignment:
| Q |
216 |
aaagtagtctttgagcccactttcttgcttatttggcaggtttttgcttagatgtcacttgctgactgtatcattttgtacacgtggattt |
306 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
41847133 |
aaagtagtctctgagcccactttcttgcttatttggcaagtttttgcttaagtgtcacttgctgactatatcattttgtgcacgtggattt |
41847043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 233 - 306
Target Start/End: Original strand, 3030516 - 3030589
Alignment:
| Q |
233 |
cactttcttgcttatttggcaggtttttgcttagatgtcacttgctgactgtatcattttgtacacgtggattt |
306 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||| || |||||||||||||||||||| |||||||| |
|
|
| T |
3030516 |
cactttcttgcttatttggcaagtttttacttagatgtcacatgttgactgtatcattttgtacaagtggattt |
3030589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 107 - 172
Target Start/End: Original strand, 3483627 - 3483692
Alignment:
| Q |
107 |
attttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctgataa |
172 |
Q |
| |
|
||||||| ||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3483627 |
attttagactaaaatatgtttttggtccctgcaaatatagcgagtttgagttttggtccctgataa |
3483692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 107 - 168
Target Start/End: Original strand, 10717115 - 10717176
Alignment:
| Q |
107 |
attttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||||| |||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10717115 |
attttaggctaaaatatgcttttggtccctgcaaatatagcgagtttgggttttggtccctg |
10717176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 112 - 168
Target Start/End: Complemental strand, 22534782 - 22534726
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||| |||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
22534782 |
aggctaaaatatgcttttgatccctgcaaatatagcgagtttgggttttggtccctg |
22534726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 108 - 167
Target Start/End: Complemental strand, 28998057 - 28997998
Alignment:
| Q |
108 |
ttttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccct |
167 |
Q |
| |
|
|||| ||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28998057 |
tttttggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttggtccct |
28997998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 111 - 168
Target Start/End: Complemental strand, 10718509 - 10718452
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||| |||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10718509 |
taggctaaaatatgcttttggtccctgcaaatatagcgagtttgggttttggtccctg |
10718452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 113 - 172
Target Start/End: Complemental strand, 1420501 - 1420442
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctgataa |
172 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||| | |||||||||||||| |
|
|
| T |
1420501 |
ggctaaaatatgtttttggtccctgcaaatatagcgagtttggatattggtccctgataa |
1420442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 393 - 432
Target Start/End: Complemental strand, 41846958 - 41846919
Alignment:
| Q |
393 |
aacagaatattaatttcctcttcttgttcttctgcatctc |
432 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41846958 |
aacagaatattaatttcctcttcttgttcttctgcatctc |
41846919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 168
Target Start/End: Complemental strand, 45518021 - 45517964
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||| |||| ||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
45518021 |
taggctaaaatatgcttttggtccctgcaagtatagcgagtttgggttttggtccctg |
45517964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 112 - 168
Target Start/End: Original strand, 36588221 - 36588277
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||| |||| ||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
36588221 |
aggctaaaatatgcttttggtccctgcaaatatagcgagtttgcgttttggtccctg |
36588277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 113 - 168
Target Start/End: Complemental strand, 4184038 - 4183983
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||| ||||| ||||| ||||||||| | ||||||||||||||||||| |
|
|
| T |
4184038 |
ggctaaaatatgcttttagtccctgcaaatatagtgcgtttgggttttggtccctg |
4183983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 112 - 167
Target Start/End: Original strand, 14197824 - 14197879
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccct |
167 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||| |||||||||| ||||||||||| |
|
|
| T |
14197824 |
aggctaaaatatgtttttggtccctgcaaatatggcgagtttggattttggtccct |
14197879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 114 - 168
Target Start/End: Original strand, 28996835 - 28996889
Alignment:
| Q |
114 |
gctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||| |||| ||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
28996835 |
gctaaaatatgattttggtccctgcaaatatagtgagtttgggttttggtccctg |
28996889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 111 - 169
Target Start/End: Complemental strand, 35115641 - 35115583
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctga |
169 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||| | |||| ||||||||||||||| |
|
|
| T |
35115641 |
taggctaaaatatggttttagtccctacaaatatacctcgttttggttttggtccctga |
35115583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 168
Target Start/End: Original strand, 22270941 - 22270998
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||| |||| |||||| |||||||||||| ||||| |||| ||||||| |
|
|
| T |
22270941 |
taggctaaaatatgcttttgatccctgcaaatatagcgaatttggattttagtccctg |
22270998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 112 - 165
Target Start/End: Complemental strand, 36589447 - 36589394
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtcc |
165 |
Q |
| |
|
||||||||||||| ||||| | ||| |||||||||||||||| ||||||||||| |
|
|
| T |
36589447 |
aggctaaaatatgattttagttcctgcaaatatagcgagtttaggttttggtcc |
36589394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 107 - 168
Target Start/End: Original strand, 38658475 - 38658536
Alignment:
| Q |
107 |
attttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||||| || | ||| | |||||||||||| |||||||||||||||||| |
|
|
| T |
38658475 |
attttaggctaaaatatgcttctggtccatgcaaatatagcgaatttgggttttggtccctg |
38658536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 112 - 168
Target Start/End: Complemental strand, 22272330 - 22272274
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||| |||| |||| |||||||||||| |||||||||||||||||| |
|
|
| T |
22272330 |
aggctaaaatatgcttttggtccccgcaaatatagcgaatttgggttttggtccctg |
22272274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 112 - 168
Target Start/End: Original strand, 22533316 - 22533372
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||| |||| ||||| | |||||||||||||||||||||||||||| |
|
|
| T |
22533316 |
aggctaaaatatgcttttggtccctgtatatatagcgagtttgggttttggtccctg |
22533372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 112 - 160
Target Start/End: Original strand, 30123151 - 30123199
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggtttt |
160 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||| |||||||||| |
|
|
| T |
30123151 |
aggctaaaatatgtttttggtccatacaaatatagcgaatttgggtttt |
30123199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 109 - 168
Target Start/End: Complemental strand, 30124286 - 30124227
Alignment:
| Q |
109 |
tttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||| |||| ||||| |||||| ||| |||||| ||||||||||||| |
|
|
| T |
30124286 |
tttaggctaaaatatgcttttggtccctgcaaataaagcaagtttgagttttggtccctg |
30124227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 114 - 168
Target Start/End: Original strand, 4182623 - 4182677
Alignment:
| Q |
114 |
gctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||| |||| ||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
4182623 |
gctaaaatatgcttttggtccctgtaaatatagcgaatttgggttttggtccctg |
4182677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 118 - 168
Target Start/End: Complemental strand, 34904563 - 34904513
Alignment:
| Q |
118 |
aaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||| ||||| ||||| |||||||||||| ||||||||||||| |||| |
|
|
| T |
34904563 |
aaatatgattttagtcccttcaaatatagcgaatttgggttttggttcctg |
34904513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 114 - 172
Target Start/End: Complemental strand, 39440480 - 39440422
Alignment:
| Q |
114 |
gctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctgataa |
172 |
Q |
| |
|
||||||||||| |||| ||| | ||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
39440480 |
gctaaaatatgcttttggtccttgcaaatatggcgagtttgagttttggtccctgataa |
39440422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 168
Target Start/End: Complemental strand, 38456791 - 38456734
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||| |||| ||||| |||||||||| | ||| |||||||||||||| |
|
|
| T |
38456791 |
taggctaaaatatgcttttggtccctgcaaatatagcaaatttaggttttggtccctg |
38456734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 115 - 164
Target Start/End: Original strand, 45516399 - 45516448
Alignment:
| Q |
115 |
ctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtc |
164 |
Q |
| |
|
|||||||||||||||| ||| | ||||||||||| |||||||||||||| |
|
|
| T |
45516399 |
ctaaaatatgtttttagtccatgtaaatatagcgaatttgggttttggtc |
45516448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 172
Target Start/End: Original strand, 10292815 - 10292875
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctgataa |
172 |
Q |
| |
|
||||||||||||| |||| ||||| |||||||||||| |||| |||||| ||| |||||| |
|
|
| T |
10292815 |
aggctaaaatatgattttggtcccttcaaatatagcgaatttgcgttttgatccttgataa |
10292875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 59; Significance: 8e-25; HSPs: 17)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 236 - 306
Target Start/End: Complemental strand, 4778809 - 4778739
Alignment:
| Q |
236 |
tttcttgcttatttggcaggtttttgcttagatgtcacttgctgactgtatcattttgtacacgtggattt |
306 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4778809 |
tttcttgcttatttggcatgtttttgcttaggtgtcacttgctgactgtatcattttgtacatgtggattt |
4778739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 108 - 168
Target Start/End: Original strand, 4565388 - 4565448
Alignment:
| Q |
108 |
ttttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4565388 |
ttttaggctaaaatatgtttttagtccctacaaatatagcgagtttgggttttggtccctg |
4565448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 112 - 168
Target Start/End: Original strand, 3936577 - 3936633
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3936577 |
aggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttggtccctg |
3936633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 115 - 167
Target Start/End: Original strand, 14809165 - 14809217
Alignment:
| Q |
115 |
ctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccct |
167 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
14809165 |
ctaaaatatgtttttgatccctacaaatatagcgaatttggattttggtccct |
14809217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 393 - 432
Target Start/End: Complemental strand, 4778647 - 4778608
Alignment:
| Q |
393 |
aacagaatattaatttcctcttcttgttcttctgcatctc |
432 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4778647 |
aacagaatattaatttcctcttcttgttcttctgcatctc |
4778608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 168
Target Start/End: Complemental strand, 3938121 - 3938064
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||| ||||| ||||| |||||||||| ||||| |||||||||||||| |
|
|
| T |
3938121 |
taggctaaaatatgcttttagtccctgcaaatatagcaagtttaggttttggtccctg |
3938064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 34910591 - 34910651
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctgataa |
172 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||| |||||| ||||||||| ||||||| |
|
|
| T |
34910591 |
taggctaaaatatgttttt-atccctgcaaatatagcaagtttgagttttggtctctgataa |
34910651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 110 - 166
Target Start/End: Original strand, 15599762 - 15599818
Alignment:
| Q |
110 |
ttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccc |
166 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||| |||| |||||||||||||||| |
|
|
| T |
15599762 |
ttaggctaaaatatgcttttggtccctacaaatatggcgaatttgggttttggtccc |
15599818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 112 - 168
Target Start/End: Complemental strand, 27571189 - 27571133
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||| |||| ||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
27571189 |
aggctaaaatatgattttggtccctgcaaatatagcgagtttgggttttgatccctg |
27571133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 110 - 168
Target Start/End: Original strand, 3954049 - 3954107
Alignment:
| Q |
110 |
ttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||||||| ||| | |||||||| ||| |||||||||||||||||| |
|
|
| T |
3954049 |
ttaggctaaaatatgtttttggtccttgcaaatatatcgaatttgggttttggtccctg |
3954107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 110 - 168
Target Start/End: Original strand, 31540493 - 31540551
Alignment:
| Q |
110 |
ttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||| ||||||||||||| |||| |
|
|
| T |
31540493 |
ttaggctaaaatatgtttttggtccctgcaaatataacgaatttgggttttggtacctg |
31540551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 113 - 168
Target Start/End: Complemental strand, 31541681 - 31541626
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| ||| ||| |||||| ||||||| |
|
|
| T |
31541681 |
ggctaaaatatgtttttgatccctgcaaatataacgaattttggtttttgtccctg |
31541626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 112 - 167
Target Start/End: Complemental strand, 34911888 - 34911833
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccct |
167 |
Q |
| |
|
||||||||||||| |||| ||||| |||||||||||||||||| ||||| ||||| |
|
|
| T |
34911888 |
aggctaaaatatgattttggtccctgcaaatatagcgagtttggattttgatccct |
34911833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 107 - 153
Target Start/End: Original strand, 25252635 - 25252681
Alignment:
| Q |
107 |
attttaggctaaaatatgtttttaatccctacaaatatagcgagttt |
153 |
Q |
| |
|
||||| ||||||||||||||||| ||| || |||||||||||||||| |
|
|
| T |
25252635 |
atttttggctaaaatatgtttttgatctctgcaaatatagcgagttt |
25252681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 107 - 153
Target Start/End: Original strand, 25316420 - 25316466
Alignment:
| Q |
107 |
attttaggctaaaatatgtttttaatccctacaaatatagcgagttt |
153 |
Q |
| |
|
||||| ||||||||||||||||| ||| || |||||||||||||||| |
|
|
| T |
25316420 |
atttttggctaaaatatgtttttgatctctgcaaatatagcgagttt |
25316466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 115 - 168
Target Start/End: Complemental strand, 3205159 - 3205106
Alignment:
| Q |
115 |
ctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||| |||| |||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
3205159 |
ctaaaatatgcttttgatccctgcaaatatgatgagtttgggttttggtccctg |
3205106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 107 - 168
Target Start/End: Original strand, 4777634 - 4777695
Alignment:
| Q |
107 |
attttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||| ||||||| ||||| ||| | ||||||||| ||||||| |||||||||||| |
|
|
| T |
4777634 |
attttaggcttaaatatgcttttagtccttgcaaatatagtaagtttggattttggtccctg |
4777695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 58; Significance: 3e-24; HSPs: 18)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 233 - 306
Target Start/End: Original strand, 19603856 - 19603929
Alignment:
| Q |
233 |
cactttcttgcttatttggcaggtttttgcttagatgtcacttgctgactgtatcattttgtacacgtggattt |
306 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| || |||||||||||||||||||| |||||||| |
|
|
| T |
19603856 |
cactttcttgcttatttggcaagtttttgcttagatgtcacatgttgactgtatcattttgtacaagtggattt |
19603929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 107 - 168
Target Start/End: Original strand, 25977864 - 25977925
Alignment:
| Q |
107 |
attttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
25977864 |
attttaggctaaaatatgtttttggtccctgcaaatatagtgagtttgggttttggtccctg |
25977925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 232 - 303
Target Start/End: Complemental strand, 11088194 - 11088123
Alignment:
| Q |
232 |
ccactttcttgcttatttggcaggtttttgcttagatgtcacttgctgactgtatcattttgtacacgtgga |
303 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||| |||||||| || ||||||| ||||| |
|
|
| T |
11088194 |
ccactttcttgcttatttggcagatttttgcttaggtgtcacttgatgactgtaccaacttgtacatgtgga |
11088123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 111 - 168
Target Start/End: Complemental strand, 2412489 - 2412432
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
2412489 |
taggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccctg |
2412432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 112 - 168
Target Start/End: Original strand, 1777468 - 1777524
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
1777468 |
aggctaaaatatgtttttggtccctgcaaatatagcgagtttgagttttggtccctg |
1777524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 113 - 165
Target Start/End: Original strand, 11087049 - 11087101
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtcc |
165 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
11087049 |
ggctaaaatatgattttaatccctgcaaatatagcgagtttggcttttggtcc |
11087101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 112 - 168
Target Start/End: Complemental strand, 25979311 - 25979255
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
25979311 |
aggctaaaatatgtttttggtccctgcaaatatagcgaatttgggttttggtccctg |
25979255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 112 - 168
Target Start/End: Original strand, 30843643 - 30843699
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||| |||||||| || |||||||| |||||||||||||||||||||| |
|
|
| T |
30843643 |
aggctaaaatatgcttttaatcactgcaaatataacgagtttgggttttggtccctg |
30843699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 220 - 286
Target Start/End: Complemental strand, 36837732 - 36837666
Alignment:
| Q |
220 |
tagtctttgagcccactttcttgcttatttggcaggtttttgcttagatgtcacttgctgactgtat |
286 |
Q |
| |
|
|||||||||| ||||||||| ||||||||| ||| ||||||||||||| |||||||||||||||| |
|
|
| T |
36837732 |
tagtctttgaacccactttcgtgcttatttagcaccattttgcttagatggcacttgctgactgtat |
36837666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 168
Target Start/End: Original strand, 23861750 - 23861807
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||| | |||||||| |||||||||||| |
|
|
| T |
23861750 |
taggctaaaatatgtttttggtccctgcaaatatggagagtttggattttggtccctg |
23861807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 168
Target Start/End: Complemental strand, 36837839 - 36837782
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||| |||||||| ||||| || || ||||||||||||||||||||||||||||||| |
|
|
| T |
36837839 |
taggttaaaatatatttttggtctctgcaaatatagcgagtttgggttttggtccctg |
36837782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 116 - 167
Target Start/End: Original strand, 12067000 - 12067051
Alignment:
| Q |
116 |
taaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccct |
167 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||| |||| |||||||||||| |
|
|
| T |
12067000 |
taaaatatgtttttggtccctacaaatataacgaatttgagttttggtccct |
12067051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 168
Target Start/End: Complemental strand, 20245367 - 20245309
Alignment:
| Q |
111 |
taggctaaaatatg-tttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||| ||||| || ||| |||||||||||| |||||||||| ||||||| |
|
|
| T |
20245367 |
taggctaaaatatggtttttgattcctgcaaatatagcgaatttgggttttagtccctg |
20245309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 110 - 172
Target Start/End: Complemental strand, 29794378 - 29794317
Alignment:
| Q |
110 |
ttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctgataa |
172 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||| |||| |||||||| |||||||| |
|
|
| T |
29794378 |
ttaggctaaaatatgttttgg-tccctgcaaatatagcgaatttgagttttggttcctgataa |
29794317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 112 - 168
Target Start/End: Original strand, 8809595 - 8809652
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatcccta-caaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
8809595 |
aggctaaaatatgtttttggtcccttgcaaatataacgaatttgggttttggtccctg |
8809652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 113 - 165
Target Start/End: Complemental strand, 1778849 - 1778797
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtcc |
165 |
Q |
| |
|
|||||||||||| |||| | ||| |||||||||||| ||||||||||||||| |
|
|
| T |
1778849 |
ggctaaaatatgcttttggttcctgcaaatatagcgactttgggttttggtcc |
1778797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 115 - 167
Target Start/End: Complemental strand, 23863107 - 23863055
Alignment:
| Q |
115 |
ctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccct |
167 |
Q |
| |
|
||||||||||||||| || || ||||||| |||||||||||||||| ||||| |
|
|
| T |
23863107 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttgatccct |
23863055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 232 - 276
Target Start/End: Original strand, 43824280 - 43824324
Alignment:
| Q |
232 |
ccactttcttgcttatttggcaggtttttgcttagatgtcacttg |
276 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| ||||||||| |
|
|
| T |
43824280 |
ccactttcttgctgatttggcagatttttgcttaagtgtcacttg |
43824324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 53; Significance: 3e-21; HSPs: 28)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 108 - 168
Target Start/End: Original strand, 17066420 - 17066480
Alignment:
| Q |
108 |
ttttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
17066420 |
ttttaggctaaaatatgcttttaatccctgcaaatatagcgagtttgggttttggtccctg |
17066480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 109 - 168
Target Start/End: Complemental strand, 41695018 - 41694959
Alignment:
| Q |
109 |
tttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
41695018 |
tttaggctaaaatatgtttttcatccctgcaaatatagcgagtttgagttttggtccctg |
41694959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 110 - 168
Target Start/End: Complemental strand, 31848206 - 31848148
Alignment:
| Q |
110 |
ttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
31848206 |
ttaggctaaaatatgtttttagtccctgcaaatatagcgaatttgggttttggtccctg |
31848148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 116 - 166
Target Start/End: Original strand, 38742184 - 38742234
Alignment:
| Q |
116 |
taaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccc |
166 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38742184 |
taaaatatgtttttagtccctgcaaatatagcgagtttgggttttggtccc |
38742234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 112 - 168
Target Start/End: Original strand, 24195606 - 24195662
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
24195606 |
aggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttgctccctg |
24195662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 112 - 168
Target Start/End: Original strand, 41693644 - 41693700
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||| |||| |||||||||||||||||| |
|
|
| T |
41693644 |
aggctaaaatatgtttttgatccctgcaaatatggcgaatttgggttttggtccctg |
41693700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 221 - 285
Target Start/End: Complemental strand, 41694906 - 41694842
Alignment:
| Q |
221 |
agtctttgagcccactttcttgcttatttggcaggtttttgcttagatgtcacttgctgactgta |
285 |
Q |
| |
|
||||||||| |||||||||||| | |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41694906 |
agtctttgaccccactttcttgttgatttggcacccttttgcttagatgtcacttgctgactgta |
41694842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 109 - 167
Target Start/End: Complemental strand, 5611570 - 5611512
Alignment:
| Q |
109 |
tttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccct |
167 |
Q |
| |
|
|||||||||||||||| |||| ||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
5611570 |
tttaggctaaaatatgattttggtccctgcaaatatagcgagtttgggttttcgtccct |
5611512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 112 - 168
Target Start/End: Original strand, 35212067 - 35212123
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
35212067 |
aggctaaaatatgtttttggtccctgcaaatatgacgagtttgggttttggtccctg |
35212123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 111 - 163
Target Start/End: Original strand, 43065999 - 43066051
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggt |
163 |
Q |
| |
|
|||| |||||||||||||| |||||| ||||||||||||||||| |||||||| |
|
|
| T |
43065999 |
taggttaaaatatgttttttatccctgcaaatatagcgagtttgagttttggt |
43066051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 114 - 165
Target Start/End: Complemental strand, 31489993 - 31489942
Alignment:
| Q |
114 |
gctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtcc |
165 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
31489993 |
gctaaaatatgtttttggtccctgcaaatataacgagtttgggttttggtcc |
31489942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 110 - 165
Target Start/End: Complemental strand, 32197971 - 32197916
Alignment:
| Q |
110 |
ttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtcc |
165 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||| ||||||||||||||| |
|
|
| T |
32197971 |
ttaggctaaaatatgcttttggtccctgcaaatatagcgaatttgggttttggtcc |
32197916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 114 - 172
Target Start/End: Original strand, 32196685 - 32196743
Alignment:
| Q |
114 |
gctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctgataa |
172 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||| ||||| |||||||||||||||| |
|
|
| T |
32196685 |
gctaaaatatgtttttggtccctgcaaatatagcgtatttggattttggtccctgataa |
32196743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 132 - 172
Target Start/End: Original strand, 554264 - 554304
Alignment:
| Q |
132 |
tccctacaaatatagcgagtttgggttttggtccctgataa |
172 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
554264 |
tccctgcaaatatagcgagtttgggttttggtccccgataa |
554304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 116 - 168
Target Start/End: Complemental strand, 12385763 - 12385711
Alignment:
| Q |
116 |
taaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||| |||| ||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
12385763 |
taaaatatgattttggtccctgcaaatatagcgagtttggattttggtccctg |
12385711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 112 - 168
Target Start/End: Original strand, 13418949 - 13419005
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||| |||| ||||||| |||||||||| |
|
|
| T |
13418949 |
aggctaaaatatgtttttggtccctgcaaatattgcgaatttgggtattggtccctg |
13419005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 110 - 144
Target Start/End: Original strand, 35665874 - 35665908
Alignment:
| Q |
110 |
ttaggctaaaatatgtttttaatccctacaaatat |
144 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35665874 |
ttaggctaaaatatggttttaatccctacaaatat |
35665908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 108 - 166
Target Start/End: Original strand, 36748193 - 36748250
Alignment:
| Q |
108 |
ttttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccc |
166 |
Q |
| |
|
|||| ||||||||||||||||| ||||| ||||||| | ||||||||||||||||||| |
|
|
| T |
36748193 |
tttttggctaaaatatgtttttggtccctgcaaatat-gagagtttgggttttggtccc |
36748250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 168
Target Start/End: Original strand, 12933417 - 12933474
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||| |||| ||||| ||||||||| ||||||| |||||||||||| |
|
|
| T |
12933417 |
taggctaaaatatgcttttggtccctgcaaatatagtgagtttgaattttggtccctg |
12933474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 168
Target Start/End: Complemental strand, 24197164 - 24197107
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||| |||| ||||| |||||||||||| |||| |||||||| |||| |
|
|
| T |
24197164 |
taggctaaaatatgcttttggtccctgcaaatatagcgaatttgagttttggttcctg |
24197107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 114 - 167
Target Start/End: Original strand, 31853549 - 31853602
Alignment:
| Q |
114 |
gctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccct |
167 |
Q |
| |
|
|||||||||||||||| ||||| ||||||| | |||||||| ||||||||||| |
|
|
| T |
31853549 |
gctaaaatatgtttttggtccctgcaaatattgtgagtttggattttggtccct |
31853602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 116 - 161
Target Start/End: Original strand, 32543483 - 32543528
Alignment:
| Q |
116 |
taaaatatgtttttaatccctacaaatatagcgagtttgggttttg |
161 |
Q |
| |
|
||||||||| |||| |||||||||||||||| ||||||||||||| |
|
|
| T |
32543483 |
taaaatatgcttttggtccctacaaatatagcaagtttgggttttg |
32543528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 116 - 165
Target Start/End: Complemental strand, 32544830 - 32544781
Alignment:
| Q |
116 |
taaaatatgtttttaatccctacaaatatagcgagtttgggttttggtcc |
165 |
Q |
| |
|
||||||||| |||| ||||| |||||||||||| ||||||||||||||| |
|
|
| T |
32544830 |
taaaatatgattttggtccctgcaaatatagcgaatttgggttttggtcc |
32544781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 113 - 165
Target Start/End: Original strand, 9454115 - 9454167
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtcc |
165 |
Q |
| |
|
|||||||||||| ||| |||||| |||| ||||| ||||||||||||||||| |
|
|
| T |
9454115 |
ggctaaaatatgctttgcatccctgcaaacatagcaagtttgggttttggtcc |
9454167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 116 - 168
Target Start/End: Complemental strand, 11217127 - 11217075
Alignment:
| Q |
116 |
taaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||| |||| ||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
11217127 |
taaaatatgcttttggtccctgcaaatatagcgagtttgaattttggtccctg |
11217075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 221 - 261
Target Start/End: Original strand, 25037856 - 25037896
Alignment:
| Q |
221 |
agtctttgagcccactttcttgcttatttggcaggtttttg |
261 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
25037856 |
agtctttgagcccactttcttgctgatttggctagtttttg |
25037896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 163
Target Start/End: Complemental strand, 39619852 - 39619800
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggt |
163 |
Q |
| |
|
|||||||||||||| |||| ||| | ||||||| |||||||||||||||||| |
|
|
| T |
39619852 |
taggctaaaatatgcttttggtccatgcaaatatggcgagtttgggttttggt |
39619800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 168
Target Start/End: Original strand, 42254957 - 42255013
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||| |||| ||||| |||||| ||||||||| ||||||||||||| |
|
|
| T |
42254957 |
aggctaaaatatgcttttggtccctgtaaatatggcgagtttgagttttggtccctg |
42255013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 53; Significance: 3e-21; HSPs: 38)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 108 - 168
Target Start/End: Complemental strand, 45268634 - 45268574
Alignment:
| Q |
108 |
ttttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
45268634 |
ttttaggctaaaatatgtttttaatccctgcaaatatagcaagtttgggttttggtccctg |
45268574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 108 - 169
Target Start/End: Complemental strand, 20585708 - 20585647
Alignment:
| Q |
108 |
ttttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctga |
169 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
20585708 |
ttttaggctaaaatatgtttttgatccctgcaaatatagcgagtttggattttggtccctga |
20585647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 108 - 167
Target Start/End: Original strand, 46026071 - 46026130
Alignment:
| Q |
108 |
ttttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccct |
167 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
46026071 |
ttttaggctaaaatatgtttttggtccctgcaaatatagcgagtttggattttggtccct |
46026130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 114 - 168
Target Start/End: Original strand, 45267306 - 45267360
Alignment:
| Q |
114 |
gctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
45267306 |
gctaaaatatgtttttgatccctgcaaatatagcgagtttgagttttggtccctg |
45267360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 112 - 161
Target Start/End: Original strand, 20802847 - 20802896
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttg |
161 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
20802847 |
aggctaaaatatgtttctagtccctacaaatatagcgagtttgggttttg |
20802896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 111 - 168
Target Start/End: Complemental strand, 39820665 - 39820608
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||| |||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39820665 |
taggctaaaatatggttttggtccctgcaaatatagcgagtttgggttttggtccctg |
39820608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 107 - 168
Target Start/End: Complemental strand, 52403189 - 52403128
Alignment:
| Q |
107 |
attttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||||| |||| ||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
52403189 |
attttaggctaaaatatgcttttggtccctgcaaatatggcgagtttgggttttggtccctg |
52403128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 107 - 168
Target Start/End: Original strand, 53121296 - 53121357
Alignment:
| Q |
107 |
attttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||| |||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
53121296 |
atttaaggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccctg |
53121357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 112 - 168
Target Start/End: Original strand, 52401016 - 52401072
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
52401016 |
aggctaaaatatgtttttggtccctgcaaatatggcgagtttgggttttggtccctg |
52401072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 112 - 167
Target Start/End: Complemental strand, 41780868 - 41780813
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccct |
167 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||| ||||||||||| ||||||| |
|
|
| T |
41780868 |
aggctaaaatatgtttttgatccctaaaaatatagcaagtttgggtttcggtccct |
41780813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 168
Target Start/End: Original strand, 4705676 - 4705736
Alignment:
| Q |
108 |
ttttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||| |||||||||||| |||| |||||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
4705676 |
tttttggctaaaatatgcttttgatccctgcaaatatggcgagtttaggttttggtccctg |
4705736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 111 - 167
Target Start/End: Complemental strand, 54437528 - 54437472
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccct |
167 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||| |||| |||||||||||| |
|
|
| T |
54437528 |
taggctaaaatatgtttttggtccctgcaaatatagcgaatttgagttttggtccct |
54437472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 112 - 167
Target Start/End: Complemental strand, 40477434 - 40477379
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccct |
167 |
Q |
| |
|
||||||||||||| |||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
40477434 |
aggctaaaatatgattttggtccctgcaaatataacgagtttgggttttggtccct |
40477379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 113 - 168
Target Start/End: Original strand, 43641143 - 43641198
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||||||||||||||| || ||||||||| |
|
|
| T |
43641143 |
ggctaaaatatgcttttagtccctgcaaatatagcgagtttggattatggtccctg |
43641198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 113 - 164
Target Start/End: Complemental strand, 52708676 - 52708625
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtc |
164 |
Q |
| |
|
|||||||||||| |||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
52708676 |
ggctaaaatatgcttttggtccctgcaaatatagcgagtttgggttttggtc |
52708625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 113 - 167
Target Start/End: Original strand, 9855178 - 9855232
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccct |
167 |
Q |
| |
|
|||||||||||| |||| |||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
9855178 |
ggctaaaatatgattttgatccctgtaaatatagcgagtttggattttggtccct |
9855232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 114 - 168
Target Start/End: Complemental strand, 20489416 - 20489362
Alignment:
| Q |
114 |
gctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||| ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
20489416 |
gctaaaatatgtttttggtccctgcaaatatgacgagtttgggttttggtccctg |
20489362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 114 - 164
Target Start/End: Original strand, 40476222 - 40476272
Alignment:
| Q |
114 |
gctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtc |
164 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||| |||||||| |
|
|
| T |
40476222 |
gctaaaatatgtttttggtccctgcaaatatagcgagtttggattttggtc |
40476272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 110 - 168
Target Start/End: Complemental strand, 47433871 - 47433813
Alignment:
| Q |
110 |
ttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||| |||| ||||||||||||| |
|
|
| T |
47433871 |
ttaggctaaaatatggttttggtccctgcaaatatagcgaatttgagttttggtccctg |
47433813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 114 - 168
Target Start/End: Complemental strand, 48035790 - 48035736
Alignment:
| Q |
114 |
gctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||| |||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
48035790 |
gctaaaatatgtttttgatccctgcaaatatgacgagtttggattttggtccctg |
48035736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 110 - 172
Target Start/End: Original strand, 52707533 - 52707595
Alignment:
| Q |
110 |
ttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctgataa |
172 |
Q |
| |
|
||||| |||||||||||||| ||| | |||||||||||| |||| ||||||||||||||||| |
|
|
| T |
52707533 |
ttaggttaaaatatgtttttggtccttgcaaatatagcgaatttgagttttggtccctgataa |
52707595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 227 - 285
Target Start/End: Complemental strand, 54437412 - 54437354
Alignment:
| Q |
227 |
tgagcccactttcttgcttatttggcaggtttttgcttagatgtcacttgctgactgta |
285 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||| ||| || || |||||||||||| |
|
|
| T |
54437412 |
tgagctcactttcttgcttatttggctggtttttgcataggtggcagttgctgactgta |
54437354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 107 - 168
Target Start/End: Original strand, 3416489 - 3416550
Alignment:
| Q |
107 |
attttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||| ||||||||||||| |||| |||||| ||||||||| ||||||| |||||||||||| |
|
|
| T |
3416489 |
atttaaggctaaaatatgattttgatccctgtaaatatagcaagtttggtttttggtccctg |
3416550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 38505642 - 38505585
Alignment:
| Q |
109 |
tttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccc |
166 |
Q |
| |
|
|||||||||||||||| |||| ||||| ||||||| ||||||||| ||||||||||| |
|
|
| T |
38505642 |
tttaggctaaaatatgcttttgctccctgcaaatatggcgagtttgagttttggtccc |
38505585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 115 - 168
Target Start/End: Original strand, 39819314 - 39819367
Alignment:
| Q |
115 |
ctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||| ||||| ||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
39819314 |
ctaaaatatggttttagtccctgcaaatatagcgagtttgaattttggtccctg |
39819367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 164
Target Start/End: Original strand, 42446524 - 42446577
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtc |
164 |
Q |
| |
|
|||||||||||||| |||| ||||| ||||||| ||||||||||||||||||| |
|
|
| T |
42446524 |
taggctaaaatatgcttttggtccctgcaaatatggcgagtttgggttttggtc |
42446577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 172
Target Start/End: Original strand, 51004140 - 51004201
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctgataa |
172 |
Q |
| |
|
|||||||||||||||||||| |||| |||||| |||| |||||||||||||||| ||||| |
|
|
| T |
51004140 |
taggctaaaatatgtttttagaccctgtaaatatggcgaatttgggttttggtcccggataa |
51004201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 112 - 168
Target Start/End: Original strand, 32635593 - 32635649
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||| ||||| ||| | |||||||||||||||||||||||||||||| |
|
|
| T |
32635593 |
aggctaaaatatattttttgtccttgtaaatatagcgagtttgggttttggtccctg |
32635649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 112 - 172
Target Start/End: Original strand, 44506581 - 44506641
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctgataa |
172 |
Q |
| |
|
||||||||||||| ||||| ||||| |||||||| ||||||| |||||| ||| ||||||| |
|
|
| T |
44506581 |
aggctaaaatatggttttagtccctgcaaatataacgagttttggtttttgtctctgataa |
44506641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 113 - 168
Target Start/End: Original strand, 46104343 - 46104398
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||| |||| ||||| ||||||||||||||||| ||||| ||||||| |
|
|
| T |
46104343 |
ggctaaaatatgattttggtccctgcaaatatagcgagtttgagtttttgtccctg |
46104398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 110 - 168
Target Start/End: Original strand, 976777 - 976835
Alignment:
| Q |
110 |
ttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||||| |||| |||||| |||||||||||| ||| ||||| ||||||| |
|
|
| T |
976777 |
ttaggctaaaatatgcttttgatccctgcaaatatagcgaatttaagttttagtccctg |
976835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 165
Target Start/End: Original strand, 22508733 - 22508787
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtcc |
165 |
Q |
| |
|
|||| ||||||||| |||| ||||| ||||||||||||||||| |||||||||| |
|
|
| T |
22508733 |
taggttaaaatatgattttggtccctgcaaatatagcgagtttgagttttggtcc |
22508787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 115 - 168
Target Start/End: Original strand, 20488368 - 20488421
Alignment:
| Q |
115 |
ctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||||| ||||| ||||||| | || |||||||||||||||||| |
|
|
| T |
20488368 |
ctaaaatatgtttttggtccctgcaaatatggtgaatttgggttttggtccctg |
20488421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 139 - 168
Target Start/End: Complemental strand, 46106797 - 46106768
Alignment:
| Q |
139 |
aaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
46106797 |
aaatatagcgagtttgggttttggtccctg |
46106768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 116 - 160
Target Start/End: Complemental strand, 15782765 - 15782721
Alignment:
| Q |
116 |
taaaatatgtttttaatccctacaaatatagcgagtttgggtttt |
160 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||| ||||| |
|
|
| T |
15782765 |
taaaatatgtttttggtccctacaaatatagcgaatttgagtttt |
15782721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 168
Target Start/End: Complemental strand, 46027477 - 46027421
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||| |||| ||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
46027477 |
aggctaaaatatacttttggtccctgcaaatatagcgagtttgaattttggtccctg |
46027421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 168
Target Start/End: Complemental strand, 53122531 - 53122475
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||| ||||| ||||| ||||||||| |||| | ||||||||||||| |
|
|
| T |
53122531 |
aggctaaaatatgcttttagtccctgcaaatatagagagtgtaagttttggtccctg |
53122475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 120 - 168
Target Start/End: Complemental strand, 55346368 - 55346320
Alignment:
| Q |
120 |
atatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||| ||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
55346368 |
atatgcttttagtctctacaaatatagcgagtttgaattttggtccctg |
55346320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 3e-18; HSPs: 36)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 113 - 168
Target Start/End: Complemental strand, 46075109 - 46075054
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
46075109 |
ggctaaaatatgtttttgatccctgcaaatatagcgagtttgggttttggtccctg |
46075054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 112 - 168
Target Start/End: Original strand, 47038865 - 47038921
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
47038865 |
aggctaaaatatgtttttagtccctgcaaatatagctagtttgggttttggtccctg |
47038921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 111 - 168
Target Start/End: Complemental strand, 27264277 - 27264220
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||| |||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27264277 |
taggctaaaatatgattttggtccctgcaaatatagcgagtttgggttttggtccctg |
27264220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 112 - 168
Target Start/End: Complemental strand, 9774948 - 9774892
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||| |||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9774948 |
aggctaaaatatgcttttggtccctgcaaatatagcgagtttgggttttggtccctg |
9774892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 112 - 168
Target Start/End: Original strand, 27262907 - 27262963
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
27262907 |
aggctaaaatatgtttttggtccctgcaaatatagcgagtttgtgttttggtccctg |
27262963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 113 - 168
Target Start/End: Complemental strand, 24427428 - 24427373
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
24427428 |
ggctaaaatatgtttttggtccctacaaatatagcgagtttgagttttagtccctg |
24427373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 232 - 303
Target Start/End: Complemental strand, 30723267 - 30723196
Alignment:
| Q |
232 |
ccactttcttgcttatttggcaggtttttgcttagatgtcacttgctgactgtatcattttgtacacgtgga |
303 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||| ||||||||| |||||||| || ||||||| ||||| |
|
|
| T |
30723267 |
ccactttcttgctgatttggcagatttttgcttaggtgtcacttgatgactgtaccaacttgtacatgtgga |
30723196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 231 - 282
Target Start/End: Complemental strand, 46074994 - 46074943
Alignment:
| Q |
231 |
cccactttcttgcttatttggcaggtttttgcttagatgtcacttgctgact |
282 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||||||||| ||||| |
|
|
| T |
46074994 |
cccactttcttgcttatttggcaggcttttgcttatatgtcacttgttgact |
46074943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 113 - 167
Target Start/End: Original strand, 24609919 - 24609973
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccct |
167 |
Q |
| |
|
||||||||||||||||| ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
24609919 |
ggctaaaatatgtttttggtccctgcaaatatggcgagtttgggttttggtccct |
24609973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 108 - 161
Target Start/End: Complemental strand, 2604191 - 2604138
Alignment:
| Q |
108 |
ttttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttg |
161 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||| | |||||||||||||| |
|
|
| T |
2604191 |
ttttaggctaaaatatgtttttagtccctgcaaatatggggagtttgggttttg |
2604138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 168
Target Start/End: Original strand, 35721099 - 35721156
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
35721099 |
taggctaaaatatgtttttggtccctgcaaatataacgaatttgggttttggtccctg |
35721156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 112 - 168
Target Start/End: Original strand, 11710552 - 11710608
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||| |||| ||||||||||||||||| |
|
|
| T |
11710552 |
aggctaaaatatgtttttgatccctgtaaatataacgaggttgggttttggtccctg |
11710608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 109 - 165
Target Start/End: Complemental strand, 34934810 - 34934754
Alignment:
| Q |
109 |
tttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtcc |
165 |
Q |
| |
|
|||||||||||||||| |||| ||||| |||||||||||| ||||||||||||||| |
|
|
| T |
34934810 |
tttaggctaaaatatgctttttgtccctgcaaatatagcgaatttgggttttggtcc |
34934754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 112 - 168
Target Start/End: Original strand, 37395632 - 37395688
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
37395632 |
aggctaaaatatgtttttggtccctgcaaatatagcgtatttgggttttggtccctg |
37395688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 111 - 171
Target Start/End: Complemental strand, 48334193 - 48334133
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctgata |
171 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||| |||| |||||||| ||||||| |
|
|
| T |
48334193 |
taggctaaaatatgcttttggtccctacaaatatagcgaatttgagttttggttcctgata |
48334133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 112 - 172
Target Start/End: Complemental strand, 48589021 - 48588961
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctgataa |
172 |
Q |
| |
|
|||||||||||||||||| ||||| |||||| | ||||||||||||||||||||||||| |
|
|
| T |
48589021 |
aggctaaaatatgtttttggtccctgtaaatatggtgagtttgggttttggtccctgataa |
48588961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 112 - 172
Target Start/End: Complemental strand, 48594108 - 48594048
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctgataa |
172 |
Q |
| |
|
|||||||||||||||||| ||||| |||||| |||||||||||||||| |||||||||| |
|
|
| T |
48594108 |
aggctaaaatatgtttttggtccctgtaaatatggcgagtttgggttttgatccctgataa |
48594048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 112 - 172
Target Start/End: Complemental strand, 48598719 - 48598659
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctgataa |
172 |
Q |
| |
|
|||||||||||||||||| ||||| |||||| |||||||||||||||| |||||||||| |
|
|
| T |
48598719 |
aggctaaaatatgtttttggtccctgtaaatatggcgagtttgggttttgatccctgataa |
48598659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 113 - 168
Target Start/End: Complemental strand, 23470028 - 23469973
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
23470028 |
ggctaaaatatgtttttggtccctgcaaatatagcgagtttcggttttgatccctg |
23469973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 109 - 168
Target Start/End: Complemental strand, 39163087 - 39163028
Alignment:
| Q |
109 |
tttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||| |||| ||||| ||||||| ||||| ||||||||||||||||| |
|
|
| T |
39163087 |
tttaggctaaaatatgcttttggtccctgcaaatatggcgaggttgggttttggtccctg |
39163028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 107 - 168
Target Start/End: Original strand, 26863854 - 26863915
Alignment:
| Q |
107 |
attttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||| |||||||||| ||||||| ||||| |||||||||||| |||| ||||||||||||| |
|
|
| T |
26863854 |
atttaaggctaaaatgtgtttttggtccctgcaaatatagcgaatttgagttttggtccctg |
26863915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 168
Target Start/End: Original strand, 46073883 - 46073940
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||| |||| |||||| |||||||||| | |||||||||| ||||||| |
|
|
| T |
46073883 |
taggctaaaatatgcttttgatccctgcaaatatagcaaatttgggttttagtccctg |
46073940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 116 - 168
Target Start/End: Original strand, 9774040 - 9774092
Alignment:
| Q |
116 |
taaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||| ||||| |||||||| |||||||| ||||||||||||| |
|
|
| T |
9774040 |
taaaatatgtttttggtccctgcaaatataacgagtttgagttttggtccctg |
9774092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 112 - 168
Target Start/End: Complemental strand, 20723748 - 20723692
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||| |||| ||||| ||||||| |
|
|
| T |
20723748 |
aggctaaaatatgtttttggtccctgcaaatatagcgaatttgagttttagtccctg |
20723692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 113 - 165
Target Start/End: Original strand, 30722116 - 30722168
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtcc |
165 |
Q |
| |
|
|||||||||||| ||||||||||| | |||||||| ||||||| ||||||||| |
|
|
| T |
30722116 |
ggctaaaatatgcttttaatccctgcgaatatagcaagtttggattttggtcc |
30722168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 113 - 168
Target Start/End: Complemental strand, 11711312 - 11711258
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||| |||||| ||||||||||| |
|
|
| T |
11711312 |
ggctaaaatatgtttttggtccctgcaaatatagcgaatttggg-tttggtccctg |
11711258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 113 - 168
Target Start/End: Original strand, 20722472 - 20722527
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||| || |||| ||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
20722472 |
ggctaaaatgtgcttttggtccctgcaaatatagcgaatttgggttttggtccctg |
20722527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 109 - 164
Target Start/End: Complemental strand, 35722348 - 35722293
Alignment:
| Q |
109 |
tttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtc |
164 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||| ||||| |||||||| |
|
|
| T |
35722348 |
tttaggctaaaatatgtttttggtccctgtaaatatagcgaatttggattttggtc |
35722293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 112 - 162
Target Start/End: Complemental strand, 45979556 - 45979506
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttgg |
162 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||| |||| ||||||| |
|
|
| T |
45979556 |
aggctaaaatatgtttttggtccctgcaaatatagcgaatttgagttttgg |
45979506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 112 - 165
Target Start/End: Complemental strand, 17977619 - 17977566
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtcc |
165 |
Q |
| |
|
||||| ||||||| |||| ||||| |||||||||||| ||||||||||||||| |
|
|
| T |
17977619 |
aggcttaaatatggttttggtccctgcaaatatagcgaatttgggttttggtcc |
17977566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 112 - 165
Target Start/End: Complemental strand, 35911948 - 35911895
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtcc |
165 |
Q |
| |
|
||||||||||||| |||| ||||| |||||||||||| ||||| ||||||||| |
|
|
| T |
35911948 |
aggctaaaatatgcttttggtccctgcaaatatagcgaatttggattttggtcc |
35911895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 112 - 165
Target Start/End: Original strand, 50164402 - 50164455
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtcc |
165 |
Q |
| |
|
||||||||||||| |||| ||||| ||||||| ||||||||| |||||||||| |
|
|
| T |
50164402 |
aggctaaaatatgcttttggtccctgcaaatatggcgagtttgagttttggtcc |
50164455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 115 - 172
Target Start/End: Original strand, 51240121 - 51240178
Alignment:
| Q |
115 |
ctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctgataa |
172 |
Q |
| |
|
||||||||||||||| || || |||||||||||| ||||| ||||| |||||||||| |
|
|
| T |
51240121 |
ctaaaatatgtttttggtctctgcaaatatagcgaatttggattttgatccctgataa |
51240178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 168
Target Start/End: Complemental strand, 24611177 - 24611121
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||||| ||||| |||||| |||||||| ||||||||||||| |
|
|
| T |
24611177 |
aggctaaaatatgtttttggtccctgtaaatatgacgagtttgagttttggtccctg |
24611121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 113 - 165
Target Start/End: Complemental strand, 37396899 - 37396847
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtcc |
165 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||||||| |||| |||||||||| |
|
|
| T |
37396899 |
ggctaaaatatgcttttggtccctgcaaatatagcgaatttgagttttggtcc |
37396847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 220 - 288
Target Start/End: Original strand, 46073991 - 46074059
Alignment:
| Q |
220 |
tagtctttgagcccactttcttgcttatttggcaggtttttgcttagatgtcacttgctgactgtatca |
288 |
Q |
| |
|
||||| |||||| || |||| |||||||| ||| |||||||||||||||||| || ||||||||||| |
|
|
| T |
46073991 |
tagtccttgagctcattttcctgcttattcggctagtttttgcttagatgtcagatgttgactgtatca |
46074059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 4e-17; HSPs: 20)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 111 - 168
Target Start/End: Complemental strand, 34998202 - 34998145
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||| |||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34998202 |
taggctaaaatatgcttttgatccctgcaaatatagcgagtttgggttttggtccctg |
34998145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 116 - 172
Target Start/End: Complemental strand, 1171707 - 1171651
Alignment:
| Q |
116 |
taaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctgataa |
172 |
Q |
| |
|
|||||||||||||| |||||| |||||||| ||||||||| |||||||||||||||| |
|
|
| T |
1171707 |
taaaatatgtttttgatccctgcaaatataacgagtttggtttttggtccctgataa |
1171651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 108 - 168
Target Start/End: Complemental strand, 17517373 - 17517313
Alignment:
| Q |
108 |
ttttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||| ||||||||| ||||||||||||| |
|
|
| T |
17517373 |
ttttaggctaaaatatgtttttggtccctgcaaatatggcgagtttgagttttggtccctg |
17517313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 113 - 171
Target Start/End: Complemental strand, 1974211 - 1974153
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctgata |
171 |
Q |
| |
|
||||||||||||||||| |||| | |||||||||||| |||| |||||||||||||||| |
|
|
| T |
1974211 |
ggctaaaatatgtttttgatccttgcaaatatagcgaatttgagttttggtccctgata |
1974153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 115 - 172
Target Start/End: Original strand, 17516164 - 17516221
Alignment:
| Q |
115 |
ctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctgataa |
172 |
Q |
| |
|
||||||||||||||| ||||| ||||||| | ||||||||||||||||||||||||| |
|
|
| T |
17516164 |
ctaaaatatgtttttggtccctgcaaatatggtgagtttgggttttggtccctgataa |
17516221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 113 - 168
Target Start/End: Original strand, 18810532 - 18810587
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||| |||| ||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
18810532 |
ggctaaaatatgattttggtccctgcaaatatagtgagtttgggttttggtccctg |
18810587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 113 - 168
Target Start/End: Original strand, 21165246 - 21165301
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||| |||| ||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
21165246 |
ggctaaaatatgcttttggtccctgcaaatatagcgagtttgtgttttggtccctg |
21165301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 109 - 167
Target Start/End: Original strand, 3276363 - 3276421
Alignment:
| Q |
109 |
tttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccct |
167 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||| ||||| |||| |||||| |
|
|
| T |
3276363 |
tttaggctaaaatatgtttttggtccctgcaaatatagcgaatttggattttagtccct |
3276421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 110 - 168
Target Start/End: Original strand, 21953203 - 21953261
Alignment:
| Q |
110 |
ttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||| ||||| |||||||||||| |
|
|
| T |
21953203 |
ttaggctaaaatatgcttttggtccctgcaaatatagcgaatttggattttggtccctg |
21953261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 168
Target Start/End: Original strand, 34995112 - 34995169
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||| |||| |||||| |||||||||||| |||| |||||||| |||| |
|
|
| T |
34995112 |
taggctaaaatatgcttttgatccctgcaaatatagcgaatttgagttttggttcctg |
34995169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 116 - 168
Target Start/End: Complemental strand, 3279555 - 3279503
Alignment:
| Q |
116 |
taaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||| ||||||| |||| |
|
|
| T |
3279555 |
taaaatatgtttttgatccctgcaaatatagcgagtttgaattttggttcctg |
3279503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 112 - 168
Target Start/End: Original strand, 16995450 - 16995506
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| || |||||||||||||||||| |
|
|
| T |
16995450 |
aggctaaaatatgtttttggtccctgcaaatataaagaatttgggttttggtccctg |
16995506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 112 - 168
Target Start/End: Original strand, 29291358 - 29291414
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||| |||| ||| | ||||||| ||||||||||||||||||||||| |
|
|
| T |
29291358 |
aggctaaaatatgcttttggtccttgcaaatatggcgagtttgggttttggtccctg |
29291414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 113 - 172
Target Start/End: Complemental strand, 17000336 - 17000277
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctgataa |
172 |
Q |
| |
|
||||||||||| |||| ||||| ||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
17000336 |
ggctaaaatatacttttggtccctgcaaatgtagtgagtttgggttttggtccctgataa |
17000277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 113 - 168
Target Start/End: Complemental strand, 20393327 - 20393272
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||| |||| |||||| |||||||||||| ||||||||| ||||||| |
|
|
| T |
20393327 |
ggctaaaatatgcttttgatccctgcaaatatagcgaatttgggtttcagtccctg |
20393272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 113 - 168
Target Start/End: Complemental strand, 20897556 - 20897501
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||| |||| ||||| ||||||||| || |||||||||||||||||| |
|
|
| T |
20897556 |
ggctaaaatatggttttggtccctgcaaatatagtgaatttgggttttggtccctg |
20897501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 115 - 161
Target Start/End: Original strand, 25439650 - 25439696
Alignment:
| Q |
115 |
ctaaaatatgtttttaatccctacaaatatagcgagtttgggttttg |
161 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| ||| ||||||||||| |
|
|
| T |
25439650 |
ctaaaatatgtttttagtccctgcaaatataacgattttgggttttg |
25439696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 1972395 - 1972447
Alignment:
| Q |
108 |
ttttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggtttt |
160 |
Q |
| |
|
|||| ||||||||||||||||| ||||| |||||| ||||| |||||||||| |
|
|
| T |
1972395 |
tttttggctaaaatatgtttttggtccctgcaaataaagcgaatttgggtttt |
1972447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 256 - 284
Target Start/End: Original strand, 3276506 - 3276534
Alignment:
| Q |
256 |
tttttgcttagatgtcacttgctgactgt |
284 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3276506 |
tttttgcttagatgtcacttgctgactgt |
3276534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 132 - 168
Target Start/End: Original strand, 26419532 - 26419568
Alignment:
| Q |
132 |
tccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||| |
|
|
| T |
26419532 |
tccctacaaatataacaagtttgggttttggtccctg |
26419568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0562 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0562
Description:
Target: scaffold0562; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 108 - 168
Target Start/End: Original strand, 9917 - 9977
Alignment:
| Q |
108 |
ttttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||||||| |||| |||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
9917 |
ttttaggctaaaatatgcttttgatccctgcaaatatagcgagtttggattttggtccctg |
9977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 2e-16; HSPs: 29)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 108 - 168
Target Start/End: Original strand, 3879081 - 3879141
Alignment:
| Q |
108 |
ttttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||||||| |||| |||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
3879081 |
ttttaggctaaaatatgcttttgatccctgcaaatatagcgagtttggattttggtccctg |
3879141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 112 - 168
Target Start/End: Complemental strand, 33137288 - 33137232
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
33137288 |
aggctaaaatatgtttttgatccctgcaaatatagcgagtttgggttttagtccctg |
33137232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 111 - 163
Target Start/End: Original strand, 38166493 - 38166545
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggt |
163 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
38166493 |
taggctaaaatatgtttttaatccctgcaaatatagcgagtttggattttggt |
38166545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 108 - 168
Target Start/End: Complemental strand, 45619795 - 45619735
Alignment:
| Q |
108 |
ttttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
45619795 |
ttttaggctaaaatatgtttttagtccctgcaaatatagcgagtttaggttttgttccctg |
45619735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 112 - 165
Target Start/End: Complemental strand, 29060942 - 29060889
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtcc |
165 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
29060942 |
aggctaaaatatgtttttaatccctgcaaatatagcgagtttgaattttggtcc |
29060889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 108 - 168
Target Start/End: Complemental strand, 42359410 - 42359350
Alignment:
| Q |
108 |
ttttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||| ||||||||||||||||| ||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
42359410 |
tttttggctaaaatatgtttttggtccctgcaaatatagcgagtttggattttggtccctg |
42359350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 112 - 167
Target Start/End: Complemental strand, 3880556 - 3880501
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccct |
167 |
Q |
| |
|
|||||||||||||||||| | ||| |||||||||||||||||||||||||||||| |
|
|
| T |
3880556 |
aggctaaaatatgtttttggttcctgcaaatatagcgagtttgggttttggtccct |
3880501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 113 - 168
Target Start/End: Original strand, 22204055 - 22204110
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
22204055 |
ggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccctg |
22204110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 113 - 172
Target Start/End: Complemental strand, 32699373 - 32699314
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctgataa |
172 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
32699373 |
ggctaaaatatgtttttggtccctgtaaatatagcgagtttgggttttggtccctcataa |
32699314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 168
Target Start/End: Original strand, 45618283 - 45618340
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||| ||||| |||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45618283 |
taggctaatatatgcttttggtccctgcaaatatagcgagtttgggttttggtccctg |
45618340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 109 - 168
Target Start/End: Original strand, 19674410 - 19674469
Alignment:
| Q |
109 |
tttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||| |||| ||| | ||||||||||||||||| ||||||||||||| |
|
|
| T |
19674410 |
tttaggctaaaatatgcttttggtccttgcaaatatagcgagtttgagttttggtccctg |
19674469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 113 - 172
Target Start/End: Complemental strand, 19675679 - 19675620
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctgataa |
172 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||| ||||||||| |||||||||||||||| |
|
|
| T |
19675679 |
ggctaaaatatgcttttggtccctgcaaatataacgagtttggattttggtccctgataa |
19675620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 112 - 168
Target Start/End: Original strand, 40198576 - 40198629
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||| |||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40198576 |
aggctaaaatatgctttt---ccctgcaaatatagcgagtttgggttttggtccctg |
40198629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 111 - 165
Target Start/End: Original strand, 41933816 - 41933870
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtcc |
165 |
Q |
| |
|
|||||||||||||| |||| || || |||||||||||||||||||||||||||| |
|
|
| T |
41933816 |
taggctaaaatatgattttggtctctgcaaatatagcgagtttgggttttggtcc |
41933870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 164
Target Start/End: Original strand, 35054660 - 35054713
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtc |
164 |
Q |
| |
|
|||| ||||||||| ||||| ||||| |||||||||||| |||||||||||||| |
|
|
| T |
35054660 |
taggttaaaatatgattttagtccctgcaaatatagcgaatttgggttttggtc |
35054713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 168
Target Start/End: Complemental strand, 54121761 - 54121704
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||| |||| ||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
54121761 |
taggctaaaatatgattttgctccctgcaaatacggcgagtttgggttttggtccctg |
54121704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 112 - 168
Target Start/End: Original strand, 17281570 - 17281626
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||| || ||||| ||||| |||||||||||| ||||| |||||||||||| |
|
|
| T |
17281570 |
aggctaaaatgtgcttttagtccctgcaaatatagcgaatttggattttggtccctg |
17281626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 112 - 168
Target Start/End: Original strand, 17370072 - 17370128
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||| || ||||| ||||| |||||||||||| ||||| |||||||||||| |
|
|
| T |
17370072 |
aggctaaaatgtgcttttagtccctgcaaatatagcgaatttggattttggtccctg |
17370128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 116 - 168
Target Start/End: Complemental strand, 17371901 - 17371849
Alignment:
| Q |
116 |
taaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||| |||| |||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
17371901 |
taaaatatgcttttgatccctgcaaatataacgaatttgggttttggtccctg |
17371849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 111 - 167
Target Start/End: Original strand, 33134889 - 33134945
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccct |
167 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| ||||||||| | ||||||||| |
|
|
| T |
33134889 |
taggctaaaatatgtttttgatccctgcaaatatgacgagtttggatattggtccct |
33134945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 112 - 172
Target Start/End: Original strand, 34659705 - 34659765
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctgataa |
172 |
Q |
| |
|
||||||||||||| |||| ||||| ||||||| ||||||| |||||||||||||||||| |
|
|
| T |
34659705 |
aggctaaaatatgcttttggtccctgcaaatatggcgagttaaggttttggtccctgataa |
34659765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 116 - 164
Target Start/End: Complemental strand, 41935126 - 41935078
Alignment:
| Q |
116 |
taaaatatgtttttaatccctacaaatatagcgagtttgggttttggtc |
164 |
Q |
| |
|
|||||||||||||| ||||| |||||||| |||||||||||||||||| |
|
|
| T |
41935126 |
taaaatatgtttttggtccctgcaaatataacgagtttgggttttggtc |
41935078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 112 - 168
Target Start/End: Complemental strand, 55542639 - 55542583
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||| ||||||| |||||| |||||||||| ||||||| ||||||||||| |
|
|
| T |
55542639 |
aggctaaaatctgtttttgatccctgcaaatatagcatgtttgggatttggtccctg |
55542583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 116 - 167
Target Start/End: Complemental strand, 16574424 - 16574373
Alignment:
| Q |
116 |
taaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccct |
167 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||| ||| |||||||||||| |
|
|
| T |
16574424 |
taaaatatgtttttagtccctgcaaatatagcgaatttaagttttggtccct |
16574373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 112 - 167
Target Start/End: Original strand, 29415545 - 29415600
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccct |
167 |
Q |
| |
|
|||||||||||| |||||||| || |||||||| |||||||| |||||||||||| |
|
|
| T |
29415545 |
aggctaaaatatatttttaattccaacaaatatgacgagtttgagttttggtccct |
29415600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 113 - 172
Target Start/End: Original strand, 32697999 - 32698058
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctgataa |
172 |
Q |
| |
|
|||||||||||| |||| |||||| |||||||||||| ||| |||||| || |||||||| |
|
|
| T |
32697999 |
ggctaaaatatgattttgatccctgcaaatatagcgaatttaggttttagttcctgataa |
32698058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 164
Target Start/End: Original strand, 16573377 - 16573429
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtc |
164 |
Q |
| |
|
||||||||||||| |||| || |||||||||| |||| |||||||||||||| |
|
|
| T |
16573377 |
aggctaaaatatgcttttggtctctacaaatatggcgaatttgggttttggtc |
16573429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 168
Target Start/End: Original strand, 42358031 - 42358087
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||| |||||| |||||| |
|
|
| T |
42358031 |
aggctaaaatatgtttttggtccctgcaaatataggaagtttgagttttgatccctg |
42358087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 230 - 262
Target Start/End: Complemental strand, 54121642 - 54121610
Alignment:
| Q |
230 |
gcccactttcttgcttatttggcaggtttttgc |
262 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
54121642 |
gcccactttcttgctgatttggcaggtttttgc |
54121610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 4)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 113 - 167
Target Start/End: Original strand, 374335 - 374389
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccct |
167 |
Q |
| |
|
|||||||||||| |||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
374335 |
ggctaaaatatgattttgatccctgcaaatatagcgagtttgggttttggtccct |
374389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 110 - 167
Target Start/End: Complemental strand, 345959 - 345902
Alignment:
| Q |
110 |
ttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccct |
167 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
345959 |
ttaggctaaaatatgtttttggtccctgcaaatatagcgaatttgggttttggtccct |
345902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 107 - 160
Target Start/End: Complemental strand, 376434 - 376381
Alignment:
| Q |
107 |
attttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggtttt |
160 |
Q |
| |
|
|||||||||||||||||| |||| ||||| ||||||||||||||||||||||| |
|
|
| T |
376434 |
attttaggctaaaatatgcttttggtccctgcaaatatagcgagtttgggtttt |
376381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 110 - 168
Target Start/End: Original strand, 344934 - 344992
Alignment:
| Q |
110 |
ttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||| ||||||| |||| ||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
344934 |
ttaggctcaaatatgattttggtccctgcaaatatggcgagtttgggttttggtccctg |
344992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0106 (Bit Score: 38; Significance: 0.000000000003; HSPs: 2)
Name: scaffold0106
Description:
Target: scaffold0106; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 111 - 168
Target Start/End: Complemental strand, 30968 - 30911
Alignment:
| Q |
111 |
taggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||| |||| ||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
30968 |
taggctaaaatatggttttggtccctgcaaatatagtgagtttgggttttggtccctg |
30911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0106; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 110 - 168
Target Start/End: Original strand, 29726 - 29784
Alignment:
| Q |
110 |
ttaggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||| | ||||||||| |||||||||||| |
|
|
| T |
29726 |
ttaggctaaaatatgcttttggtccctgcaaataaaacgagtttggattttggtccctg |
29784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0517 (Bit Score: 37; Significance: 0.00000000001; HSPs: 2)
Name: scaffold0517
Description:
Target: scaffold0517; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 112 - 168
Target Start/End: Complemental strand, 11582 - 11526
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
11582 |
aggctaaaatatgtttttggtccctgcaaatatagcgtatttgggttttggtccctg |
11526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0517; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 113 - 165
Target Start/End: Original strand, 10315 - 10367
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtcc |
165 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||||||| |||| |||||||||| |
|
|
| T |
10315 |
ggctaaaatatgcttttggtccctgcaaatatagcgaatttgagttttggtcc |
10367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0230 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0230
Description:
Target: scaffold0230; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 113 - 168
Target Start/End: Complemental strand, 490 - 435
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||| |||| ||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
490 |
ggctaaaatatgattttggtccctgcaaatatagtgagtttgggttttggtccctg |
435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 113 - 168
Target Start/End: Complemental strand, 121044 - 120989
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
121044 |
ggctaaaatatgcttttggtccctgcaaatataacgagtttgggttttggtccctg |
120989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 113 - 168
Target Start/End: Original strand, 119593 - 119648
Alignment:
| Q |
113 |
ggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctg |
168 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||||||| |||| ||||||||||||| |
|
|
| T |
119593 |
ggctaaaatatgcttttggtccctgcaaatatagcgaatttgagttttggtccctg |
119648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0095 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0095
Description:
Target: scaffold0095; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 114 - 172
Target Start/End: Complemental strand, 42813 - 42755
Alignment:
| Q |
114 |
gctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccctgataa |
172 |
Q |
| |
|
||||||||||| |||| ||| | ||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
42813 |
gctaaaatatgcttttggtccttgcaaatatggcgagtttgagttttggtccctgataa |
42755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 112 - 166
Target Start/End: Original strand, 202578 - 202632
Alignment:
| Q |
112 |
aggctaaaatatgtttttaatccctacaaatatagcgagtttgggttttggtccc |
166 |
Q |
| |
|
||||||||||||| |||| ||||| |||||||| ||||||||| |||||||||| |
|
|
| T |
202578 |
aggctaaaatatgcttttggtccctgcaaatataacgagtttggattttggtccc |
202632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University