View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3992_low_37 (Length: 305)

Name: NF3992_low_37
Description: NF3992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3992_low_37
NF3992_low_37
[»] chr1 (1 HSPs)
chr1 (23-293)||(47887737-47888007)


Alignment Details
Target: chr1 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 23 - 293
Target Start/End: Original strand, 47887737 - 47888007
Alignment:
23 tgtctgcagccaacaaacttggtgtggatgccatctttgtttacacaaaacatggatatatggcatcattactatctcgcaaccgtccagatcctcccat 122  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47887737 tgtctgcagccaacaaacttggtgtggatgccatctttgtttacacaaaacatggatatatggcatcattactatctcgcaaccgtccagatcctcccat 47887836  T
123 ctttgctttcaccgacgatgaaagtactcgaatggctctgaatttgcaatggggtgttgtaccacttcttgttgatttatcagatgatgctgaatcaaat 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47887837 ctttgctttcaccgacgatgaaagtactcgaatggctctgaatttgcaatggggtgttgtaccacttcttgttgatttatcagatgatgctgaatcaaat 47887936  T
223 atctcaaaatctgttcagcttatgaaatctaaaggattaatcaacaaaggagatgttgttctagtggtctc 293  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47887937 atctcaaaatctgttcagcttatgaaatctaaaggattaatcaacaaaggagatgttgttctagtggtctc 47888007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University