View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3992_low_37 (Length: 305)
Name: NF3992_low_37
Description: NF3992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3992_low_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 23 - 293
Target Start/End: Original strand, 47887737 - 47888007
Alignment:
| Q |
23 |
tgtctgcagccaacaaacttggtgtggatgccatctttgtttacacaaaacatggatatatggcatcattactatctcgcaaccgtccagatcctcccat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47887737 |
tgtctgcagccaacaaacttggtgtggatgccatctttgtttacacaaaacatggatatatggcatcattactatctcgcaaccgtccagatcctcccat |
47887836 |
T |
 |
| Q |
123 |
ctttgctttcaccgacgatgaaagtactcgaatggctctgaatttgcaatggggtgttgtaccacttcttgttgatttatcagatgatgctgaatcaaat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47887837 |
ctttgctttcaccgacgatgaaagtactcgaatggctctgaatttgcaatggggtgttgtaccacttcttgttgatttatcagatgatgctgaatcaaat |
47887936 |
T |
 |
| Q |
223 |
atctcaaaatctgttcagcttatgaaatctaaaggattaatcaacaaaggagatgttgttctagtggtctc |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47887937 |
atctcaaaatctgttcagcttatgaaatctaaaggattaatcaacaaaggagatgttgttctagtggtctc |
47888007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University