View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3992_low_39 (Length: 296)
Name: NF3992_low_39
Description: NF3992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3992_low_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 13 - 122
Target Start/End: Original strand, 47236231 - 47236340
Alignment:
| Q |
13 |
aatattgcaaaagttgcaagggatgtagcaaagttgctctgcagctgcaggtgcaacatcgatgctgcagctagacatgtctctacaaggaagattcttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47236231 |
aatattgcaaaagttgcaagggatgtagcaaagttgctctgcagctgcaggtgcaacatcgatgctgcagctagacatgtctctacaaggaagattcttt |
47236330 |
T |
 |
| Q |
113 |
tacaaaaaca |
122 |
Q |
| |
|
|||||||||| |
|
|
| T |
47236331 |
tacaaaaaca |
47236340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 178 - 281
Target Start/End: Original strand, 47236392 - 47236493
Alignment:
| Q |
178 |
attaaatatcttgcaagggataccaaagttgaagagaaaggnnnnnnnnnnnnnnnnnttctttccaaacctctacttggtttgtgtatatttataagct |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47236392 |
attaaatatcttgcaagggataccaaagttgaagagaaaggtctctctctctctct--ttatttccaaacctctacttggtttgtgtatatttataagct |
47236489 |
T |
 |
| Q |
278 |
aggt |
281 |
Q |
| |
|
|||| |
|
|
| T |
47236490 |
aggt |
47236493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University