View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3992_low_42 (Length: 293)

Name: NF3992_low_42
Description: NF3992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3992_low_42
NF3992_low_42
[»] chr3 (4 HSPs)
chr3 (18-179)||(34864875-34865036)
chr3 (18-163)||(34869258-34869401)
chr3 (239-287)||(34865096-34865144)
chr3 (239-287)||(34869473-34869521)
[»] chr7 (1 HSPs)
chr7 (56-126)||(13381077-13381147)


Alignment Details
Target: chr3 (Bit Score: 158; Significance: 4e-84; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 18 - 179
Target Start/End: Original strand, 34864875 - 34865036
Alignment:
18 tgaaggtgatggagatgagattcatgcagcattaactgagtggacagggcaaaggacagtacctaatgtgtttattggaggcaagcacattggtggttgt 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34864875 tgaaggtgatggagatgagattcatgcagcattaactgagtggacagggcaaaggacagtacctaatgtgtttattggaggcaagcacattggtggttgt 34864974  T
118 gactgtaaggctacacactcatgttgcttctttttcatgtggcaaagacaaaactagacttg 179  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
34864975 gactgtaaggctacacactcatgttgcttctttttcacgtggcaaagacaaaactagacttg 34865036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 18 - 163
Target Start/End: Original strand, 34869258 - 34869401
Alignment:
18 tgaaggtgatggagatgagattcatgcagcattaactgagtggacagggcaaaggacagtacctaatgtgtttattggaggcaagcacattggtggttgt 117  Q
    |||||||||||| | ||||||||| ||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
34869258 tgaaggtgatgggggtgagattcaagcagcattagctgagtggacagggcaaaggacagtacctaacgtgtttattggaggcaagcacattggtggttgt 34869357  T
118 gactgtaaggctacacactcatgttgcttctttttcatgtggcaaa 163  Q
    || ||||||||  ||||||| | ||||| |||||||| | ||||||    
34869358 gattgtaaggc--cacactccttttgctactttttcacgaggcaaa 34869401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 239 - 287
Target Start/End: Original strand, 34865096 - 34865144
Alignment:
239 tgcagctgttttggagaaacaccgtgcaggtcaattgattcctcttctc 287  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||    
34865096 tgcagctattttggagaaacaccgtgcaggtcaattgattcctcttctc 34865144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 239 - 287
Target Start/End: Original strand, 34869473 - 34869521
Alignment:
239 tgcagctgttttggagaaacaccgtgcaggtcaattgattcctcttctc 287  Q
    ||||||||||||||||||||||||  ||||||||||| |||| ||||||    
34869473 tgcagctgttttggagaaacaccggacaggtcaattggttccccttctc 34869521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 56 - 126
Target Start/End: Complemental strand, 13381147 - 13381077
Alignment:
56 agtggacagggcaaaggacagtacctaatgtgtttattggaggcaagcacattggtggttgtgactgtaag 126  Q
    ||||||| || || ||||| || || ||||| |||||||| ||||| ||||||||||| ||||||||||||    
13381147 agtggactggtcagaggactgtgccaaatgtttttattggcggcaaccacattggtggctgtgactgtaag 13381077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University