View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3992_low_66 (Length: 237)
Name: NF3992_low_66
Description: NF3992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3992_low_66 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 123 - 221
Target Start/End: Complemental strand, 16343503 - 16343403
Alignment:
| Q |
123 |
catcctgtttttcgtaacctgatagatttcactaaactttagttt-ctttataactcgatagttttgagaatc-ttaatatttttcattttgacaagttt |
220 |
Q |
| |
|
||||||||||||| |||| | ||||||| |||||||||| ||||| ||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
16343503 |
catcctgtttttcctaacttcatagattacactaaacttcagttttctttataactcgatagttttgagaatctttaatatttttcatattgacaagttt |
16343404 |
T |
|
| Q |
221 |
t |
221 |
Q |
| |
|
| |
|
|
| T |
16343403 |
t |
16343403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University