View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3993_high_11 (Length: 255)
Name: NF3993_high_11
Description: NF3993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3993_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 62 - 239
Target Start/End: Original strand, 33636962 - 33637139
Alignment:
| Q |
62 |
gatgctgttccatattcaaggaactttactaaggaacctgtttttgtttctggagctgaacaggtttatcctcttttaagattagtagttgattgctatt |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33636962 |
gatgctgttccatattcaaggaactttactaaggaacctgtttttgtttctggagctgaacaggtttatcctcttttaagattagtagttgattgctatt |
33637061 |
T |
|
| Q |
162 |
atctttttacataaactatgtagttgttatcttttagcaaatttgtgtttggtgtctggagctgagaagtttagttga |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33637062 |
atctttttacataaactatgtagttgttatcttttagcaaatttgtgtttggtgtctggagctgagaagtttagttga |
33637139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University