View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3993_low_11 (Length: 255)

Name: NF3993_low_11
Description: NF3993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3993_low_11
NF3993_low_11
[»] chr4 (1 HSPs)
chr4 (62-239)||(33636962-33637139)


Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 62 - 239
Target Start/End: Original strand, 33636962 - 33637139
Alignment:
62 gatgctgttccatattcaaggaactttactaaggaacctgtttttgtttctggagctgaacaggtttatcctcttttaagattagtagttgattgctatt 161  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33636962 gatgctgttccatattcaaggaactttactaaggaacctgtttttgtttctggagctgaacaggtttatcctcttttaagattagtagttgattgctatt 33637061  T
162 atctttttacataaactatgtagttgttatcttttagcaaatttgtgtttggtgtctggagctgagaagtttagttga 239  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33637062 atctttttacataaactatgtagttgttatcttttagcaaatttgtgtttggtgtctggagctgagaagtttagttga 33637139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University