View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3994_high_14 (Length: 274)
Name: NF3994_high_14
Description: NF3994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3994_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 21 - 264
Target Start/End: Original strand, 13143925 - 13144168
Alignment:
| Q |
21 |
caattaggcaatgagaactcccgaattacactggctcacccaccacattctcttcaatttccaagaaaggtggtaaacattcgacgtggtttaccgattc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13143925 |
caattaggcaatgagaactcccgaattacactggctcacccaccacattctcttcaatttccaaaaaaagtggtaaacattcgacgtggtttaccgattc |
13144024 |
T |
 |
| Q |
121 |
aagagccaaacgacacattaaagacgctttttgagagacatatgcagattgtcacacctaactttaacaacaaaatggttcacaattggagggcccataa |
220 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
13144025 |
aagagcgaaacgacacattgaagacgctttttgagagacatatgcagattgtcacacctaactttaacaacaaaatggttcacaattggagggcccgtaa |
13144124 |
T |
 |
| Q |
221 |
ttactcacaggatcaattgttgtttggttcactagtgccctatg |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
13144125 |
ttactcacaggatcaattgttgtttggttcaccaatgccctatg |
13144168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University