View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3994_high_6 (Length: 340)
Name: NF3994_high_6
Description: NF3994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3994_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 57; Significance: 9e-24; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 251 - 323
Target Start/End: Complemental strand, 52002609 - 52002537
Alignment:
| Q |
251 |
tcatcagcaatcgaactttgtttttcgtccttaaccaagtattataagcatattccatatgtcacttcttttc |
323 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||| |
|
|
| T |
52002609 |
tcatcagcaattgaactttgtttttcgtccttaaccaagtattataagcatattgcatacgtctcttcttttc |
52002537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 251 - 330
Target Start/End: Complemental strand, 5174806 - 5174727
Alignment:
| Q |
251 |
tcatcagcaatcgaactttgtttttcgtccttaaccaagtattataagcatattccatatgtcacttcttttcgtctgtg |
330 |
Q |
| |
|
||||||||||| ||| |||||||||| ||||||||||| ||| ||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
5174806 |
tcatcagcaattgaagtttgtttttcatccttaaccaaatataataagcatattccatatctcacttcttttcgtttgtg |
5174727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University